Category:Genes - Revision history

Zhangzhang: Replaced content with "A collection of rice genes."

2014-10-16T08:51:54Z

Replaced content with "A collection of rice genes."

Jiangguangf at 07:56, 9 June 2014

2014-06-09T07:56:24Z

Jiangguangf at 07:45, 9 June 2014

2014-06-09T07:45:22Z

Jiangguangf at 07:35, 9 June 2014

2014-06-09T07:35:40Z

Liying: Blanked the page

2014-05-21T05:20:44Z

Blanked the page

Liying at 05:20, 21 May 2014

2014-05-21T05:20:00Z

Liying at 05:03, 21 May 2014

2014-05-21T05:03:54Z

Liying at 04:58, 21 May 2014

2014-05-21T04:58:29Z

Kaweh at 04:52, 21 May 2014

2014-05-21T04:52:32Z

Gangirl at 07:01, 19 May 2014

2014-05-19T07:01:37Z

← Older revision		Revision as of 08:51, 16 October 2014
Line 1:		Line 1:
−	~~The~~ rice ''RSS3'' gene encoding a nucleoprotein. It with R/B bHLH transcription factors regulating structure domain is homologous, for its root root elongation of the cell elongation and high salt regulation plays an important role.	+	A collection of rice genes.
−
−	~~== Annotated Information ==~~
−	~~=== Function ===~~
−
−	~~This gene is called RICE SALT SENSITIVE3. It encodes a nucleoprotein, for its root root elongation of the cell elongation and high salt regulation plays an important role <ref name="ref1" />.~~
−
−	"RSS3" to bHLH089 and bHLH094 interactions of transcription factors, also can and JAZ protein interactions, With bHLH094 and JAZ9 form ternary complexes, therefore, RSS3 - JAZ9 can inhibit bHLH094 mediated transcription activation.Rss3 mutant under exogenous JA missing, leading to cell elongation decreased, but does not affect the root of life.And known as JAs in addition to the common regulation of the root of the role of outside, also can regulate the expression of JA response genes~~, and maintained in the stress environment root cells play an important role in appropriate rate of elongation <ref name="ref1" />.~~
−
−	~~=== Mutant phenotype ===~~
−	Rss3 mutant root cell elongation is flawed, and the root of flexible variation.In the high salt environment, rss3 relatively wild type root growth severely damaged, in the high salt stress, root growth was moderate inhibition <ref name="ref1" />.
−
−	~~=== Expression ===~~
−	~~This gene is strongly expressed in the root, and especially the root tip <ref name="ref1" />~~.
−
−	~~== References ==~~
−	~~<references>~~
−	<ref name="ref1">Yosuke Toda;Maiko Tanaka;Daisuke Ogawa;Kyo Kurata;Ken-ichi Kurotani;Yoshiki Habu;Tsuyu Ando;Kazuhiko Sugimoto;Nobutaka Mitsuda;Etsuko Katoh;Kiyomi Abe;Akio Miyao;Hirohiko Hirochika;Tsukaho Hattori;Shin Takeda
−	~~RICE SALT SENSITIVE3 Forms a Ternary Complex with JAZ and Class-C bHLH Factors and Regulates Jasmonate-Induced Gene Expression and Root Cell Elongation The Plant Cell, 2013, 25(5): 1709-1725~~

@@ Line 1: / Line 1: @@
-The rice ''RSS3'' gene encoding a nucleoprotein. It with R/B homologous bHLH transcription factors regulating structure domain, for its root root elongation of the cell elongation and high salt regulation plays an important role.
+The rice ''RSS3'' gene encoding a nucleoprotein. It with R/B bHLH transcription factors regulating structure domain is homologous, for its root root elongation of the cell elongation and high salt regulation plays an important role.
 == Annotated Information ==
@@ Line 6: / Line 6: @@
 This gene is called RICE SALT SENSITIVE3. It encodes a nucleoprotein, for its root root elongation of the cell elongation and high salt regulation plays an important role <ref name="ref1" />.
-RSS3 to bHLH089 and bHLH094 interactions of transcription factors, also can and JAZ protein interactions, with bHLH094 JAZ9 ternary complex formation, and therefore, RSS3 - JAZ9 can inhibit bHLH094 mediated transcription activation.Rss3 mutant under exogenous JA missing, leading to cell elongation decreased, but does not affect the root of life.And known as JAs in addition to the common regulation of the root of the role of outside, also can regulate the expression of JA response genes, and maintained in the stress environment root cells play an important role in appropriate rate of elongation <ref name="ref1" />.
+"RSS3" to bHLH089 and bHLH094 interactions of transcription factors, also can and JAZ protein interactions, With bHLH094 and JAZ9 form ternary complexes, therefore, RSS3 - JAZ9 can inhibit bHLH094 mediated transcription activation.Rss3 mutant under exogenous JA missing, leading to cell elongation decreased, but does not affect the root of life.And known as JAs in addition to the common regulation of the root of the role of outside, also can regulate the expression of JA response genes, and maintained in the stress environment root cells play an important role in appropriate rate of elongation <ref name="ref1" />.
 === Mutant phenotype ===

@@ Line 16: / Line 16: @@
 == References ==
 <references>
 <ref name="ref1">Yosuke Toda;Maiko Tanaka;Daisuke Ogawa;Kyo Kurata;Ken-ichi Kurotani;Yoshiki Habu;Tsuyu Ando;Kazuhiko Sugimoto;Nobutaka Mitsuda;Etsuko Katoh;Kiyomi Abe;Akio Miyao;Hirohiko Hirochika;Tsukaho Hattori;Shin Takeda

← Older revision	Revision as of 07:35, 9 June 2014
Line 1:	Line 1:
	+	The rice ''RSS3'' gene encoding a nucleoprotein. It with R/B homologous bHLH transcription factors regulating structure domain, for its root root elongation of the cell elongation and high salt regulation plays an important role.

	+	== Annotated Information ==
	+	=== Function ===
	+
	+	This gene is called RICE SALT SENSITIVE3. It encodes a nucleoprotein, for its root root elongation of the cell elongation and high salt regulation plays an important role <ref name="ref1" />.
	+
	+	RSS3 to bHLH089 and bHLH094 interactions of transcription factors, also can and JAZ protein interactions, with bHLH094 JAZ9 ternary complex formation, and therefore, RSS3 - JAZ9 can inhibit bHLH094 mediated transcription activation.Rss3 mutant under exogenous JA missing, leading to cell elongation decreased, but does not affect the root of life.And known as JAs in addition to the common regulation of the root of the role of outside, also can regulate the expression of JA response genes, and maintained in the stress environment root cells play an important role in appropriate rate of elongation <ref name="ref1" />.
	+
	+	=== Mutant phenotype ===
	+	Rss3 mutant root cell elongation is flawed, and the root of flexible variation.In the high salt environment, rss3 relatively wild type root growth severely damaged, in the high salt stress, root growth was moderate inhibition <ref name="ref1" />.
	+
	+	=== Expression ===
	+	This gene is strongly expressed in the root, and especially the root tip <ref name="ref1" />.
	+
	+	== References ==
	+	<references>
	+	<ref name="ref1">Yosuke Toda;Maiko Tanaka;Daisuke Ogawa;Kyo Kurata;Ken-ichi Kurotani;Yoshiki Habu;Tsuyu Ando;Kazuhiko Sugimoto;Nobutaka Mitsuda;Etsuko Katoh;Kiyomi Abe;Akio Miyao;Hirohiko Hirochika;Tsukaho Hattori;Shin Takeda

← Older revision		Revision as of 05:20, 21 May 2014
Line 1:		Line 1:
−	~~{{Plastid\|~~
−	~~GeneName = WEP~~
−	~~Description =~~
−	~~Version =~~
−	~~Length =~~
−	~~Definition =~~
−	~~Source =~~

−	~~ORGANISM Oryza sativa Japonica Group~~
−	~~Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;~~
−	~~Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP~~
−	~~clade; Ehrhartoideae; Oryzeae; Oryza.~~
−	\|
−	~~Chromosome = [[:category:Japonica Plastid\|Plastid]]\|~~
−	~~AP = Plastid:34210..35733\|~~
−	~~CDS = 34210..35733\|~~
−	~~GCID = <gbrowseImage3>~~
−	~~name=NC_001320:34210..35733~~
−	~~source=Rice_Japonica_Plastid~~
−	~~preset=GeneLocation~~
−	~~</gbrowseImage3>\|~~
−	~~GSID = <gbrowseImage2>~~
−	~~name=NC_001320:34210..35733~~
−	~~source=Rice_Japonica_Plastid~~
−	~~preset=GeneLocation~~
−	~~</gbrowseImage2>\|~~
−	AA = <aaseq>MATLRVDEIHKILRERIEQYNRKVGIENIGRVVQVGDGIARIIGLGEIMSGELVEFAEGTRGIALNLESKNVGIVLMGDGLMIQEGSFVKATGRIAQIPVSEAYLGRVINALAKPIDGRGEIVASESRLIESPAPGIISRRSVYEPLQTGLIAIDSMIPIGRGQRELIIGDRQTGKTAVATDTILNQKGQDVICVYVAIGQRASSVAQVVTTFHEEGAMEYTIVVAEMADSPATLQYLAPYTGAALAEYFMYRERHTLIIYDDLSKQAQAYRQMSLLLRRPPGREAYPGDVFYLHSRLLERAAKLNSLLGEGSMTALPIVETQSGDVSAYIPTNVISITDGQIFLSADLFNAGIRPAINVGISVSRVGSAAQIKAMKQVAGKSKLELAQFAELQAFAQFASALDKTSQNQLARGRRLRELLKQSQANPLPVEEQIATIYIGTRGYLDSLEIGQVKKFLDELRKHLKDTKPQFQEIISSSKTFTEEAEILLKEAIQEQLERFSLQEQT</aaseq>\|
−	DNA = <dnaseqindica>1..1524#atggcaacccttcgagtcgacgaaattcataaaattctccgcgaacgtattgaacaatataatagaaaagtagggattgagaatatcggtcgcgtagttcaagtgggggatgggattgctcgtattataggtcttggtgaaataatgtcaggcgaattagtcgaatttgcagaagggactaggggtattgctctgaatttggaatccaaaaatgttgggattgtattaatgggcgatgggttgatgatacaagagggcagttttgtaaaagcaacaggaagaattgctcagatacccgtgagcgaggcttacttgggtcgtgttataaatgctctggctaaacctattgatgggagaggcgaaattgtagcttcggaatctcgcttaattgaatctcctgctccgggtataatttccaggcgttctgtatatgaaccccttcaaacggggcttattgctatcgattcgatgattcctattgggcgcggtcagcgagagttaattattggggacagacaaaccggcaaaacagcagtagctacagatacaattctcaatcaaaaagggcaagatgtaatatgtgtttatgtagctatcggtcaaagagcatcctccgtagctcaagtagtaactactttccatgaagagggggccatggaatacactattgtagtagctgaaatggcggattcccctgctacattacaatacctcgctccttatacgggagcagccctggctgagtattttatgtaccgcgaacggcatactttaataatttatgatgatctctccaaacaggcacaagcttatcgccaaatgtcccttctattaagaagaccccccggccgcgaagcttacccaggggatgttttttatttgcattcacgccttttagaaagagccgctaaattaaattctcttttaggggaaggaagtatgactgctttaccaatagttgagactcaatctggagacgtttccgcctatattcctactaatgtaatctccattacagatggacaaatattcttatccgcagatctattcaatgccggaattcggcctgctattaatgtgggtatttccgtttccagagtaggatccgcggctcaaattaaagccatgaaacaagtagctggcaaatcaaaattggaattagctcaattcgcggagttacaagcctttgcacaattcgcctctgctctcgataaaacaagtcagaatcaattggcaaggggccgacgattacgagaattgcttaaacaatcccaagcaaatcctcttccagtggaagagcagatagctactatttatatcggaacaagaggatatcttgattccttagaaattggacaggtaaagaaatttctggatgagttacgtaaacacctaaaagatactaaacctcaattccaagaaattatatcttctagcaagacattcaccgaggaagcggaaatccttttgaaggaagctattcaggaacaactcgaacggttttcccttcaggaacaaacataa</dnaseqindica>\|
−	~~Link = [http://www.ncbi.nlm.nih.gov/gene?term=3131390 NCBI Gene:atpA]~~
−	}}
−	~~[[Category:Genes]]~~
−	~~[[Category:Japonica mRNA]]~~
−	~~[[Category:Oryza Sativa Japonica Group]]~~
−	~~[[Category:Japonica Genes]]~~
−	~~[[Category:Japonica Plastid]]~~
−	~~[[Category:Plastid]]~~

@@ Line 1: / Line 1: @@
 {{Plastid|
-GeneName = atpA|
+GeneName = WEP
-Description = ATP synthase CF1 alpha subunit|
+Description =
-Version = GeneID:3131390|
+Version =
-Length = 1524 bp|
+Length =
-Definition = Oryza sativa Japonica Group ''atpA'', Plastid gene.|
+Definition =
-Source = Oryza sativa Japonica Group
+Source =
    ORGANISM  Oryza sativa Japonica Group

@@ Line 1: / Line 1: @@
 Rice genes, including ''Oryza sativa'' ''[[:Category:Japonica Genes|Japonica]]'' and ''[[:Category:Indica Genes|Indica]]''.
-Gene Name=chalk5
+Gene Name=WEP
 Descrition=putative protein phosphatase with Kelch-like repeat domain (OsPPKL1)|
 version=

← Older revision		Revision as of 07:01, 19 May 2014
Line 1:		Line 1:
	Rice genes, including ''Oryza sativa'' ''[[:Category:Japonica Genes\|Japonica]]'' and ''[[:Category:Indica Genes\|Indica]]''.		Rice genes, including ''Oryza sativa'' ''[[:Category:Japonica Genes\|Japonica]]'' and ''[[:Category:Indica Genes\|Indica]]''.
		+	Gene Name=qGL3\|
		+	Descrition=putative protein phosphatase with Kelch-like repeat domain (OsPPKL1)\|
		+	version=