Os05g0442400 - Revision history

192.168.72.52: /* Structured Information */

2015-06-12T07:39:19Z

‎Structured Information

Zhangsha: /* Annotated Information */

2014-06-08T11:17:40Z

‎Annotated Information

Zhangsha: /* Function */

2014-06-08T11:09:30Z

‎Function

Zhangsha: /* Expression */

2014-06-08T11:08:22Z

‎Expression

Zhangsha: /* References */

2014-06-08T10:52:21Z

‎References

Zhangsha: /* Expression */

2014-06-08T10:46:18Z

‎Expression

Zhangsha: /* Function */

2014-06-08T10:45:56Z

‎Function

124.16.129.48 at 20:11, 22 July 2012

2012-07-22T20:11:06Z

127.0.0.1: Created page with "{{JaponicaGene| GeneName = Os05g0442400| Description = Similar to MybSt1| Version = NM_001062206.1 GI:115464142 GeneID:4338925| Length = 1198 bp| Definition = Oryza sativ..."

2012-06-24T10:23:30Z

Created page with "{{JaponicaGene| GeneName = Os05g0442400| Description = Similar to MybSt1| Version = NM_001062206.1 GI:115464142 GeneID:4338925| Length = 1198 bp| Definition = Oryza sativ..."

New page

{{JaponicaGene|
GeneName = Os05g0442400|
Description = Similar to MybSt1|
Version = NM_001062206.1 GI:115464142 GeneID:4338925|
Length = 1198 bp|
Definition = Oryza sativa Japonica Group Os05g0442400, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 5|Chromosome 5]]|
AP = Chromosome 5:21699994..21701191|
CDS = 21700263..21700449,21700718..21701079|
GCID = <gbrowseImage1>
name=NC_008398:21699994..21701191
source=RiceChromosome05
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008398:21699994..21701191
source=RiceChromosome05
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgttctacctcggcagcatgggtggctcgccatcgtcatggggggtggcggaggtgccggtgccgagcagcaggccgtggagcaaggcggaggacaaggtgttcgagagcgcgctcgtggcgttcccggagcacacgcacaaccggtgggcgctcgtcgcgtcgcggctcccggggcgctcggcgcacgaggtttgggaacactaccaggtgctcgtggacgatgtcgacctcatcgagcgtggcatggttgcgtccccgggctgctgggacgacgacaacaacagcgccggccacggccgtggcagtggtggggatgagcgtcgtcgcggcgtgccctggactgaggaggagcacaggctatttcttgaagggctagagaaatatgggcgtggcgactggcgcaacatctcgcgctggtcggtgaagacgcggactccgacgcaagtggcgagccatgcgcagaagttcttcatccgacaggccaacgccagcagccgtggcgactccaagcgtaagagcatccacgacatcactgccccatga</cdnaseq>|
AA = <aaseq>MAFYLGSMGGSPSSWGVAEVPVPSSRPWSKAEDKVFESALVAFP EHTHNRWALVASRLPGRSAHEVWEHYQVLVDDVDLIERGMVASPGCWDDDNNSAGHGR GSGGDERRRGVPWTEEEHRLFLEGLEKYGRGDWRNISRWSVKTRTPTQVASHAQKFFI RQANASSRGDSKRKSIHDITAP</aaseq>|
DNA = <dnaseqindica>743..929#113..474#agatccaaggctatctaagcaccggcatttgcatacagccgcctaagcaaagagcacagcaagtatacgcgaatctgagtgtgtgagagagactagtagcacagacgaaggtatggcgttctacctcggcagcatgggtggctcgccatcgtcatggggggtggcggaggtgccggtgccgagcagcaggccgtggagcaaggcggaggacaaggtgttcgagagcgcgctcgtggcgttcccggagcacacgcacaaccggtgggcgctcgtcgcgtcgcggctcccggggcgctcggcgcacgaggtttgggaacactaccaggtgctcgtggacgatgtcgacctcatcgagcgtggcatggttgcgtccccgggctgctgggacgacgacaacaacagcgccggccacggccgtggcagtggtggggatgagcgtcgtcgcggcgtgccctggactgaggaggagcacaggtatgtgtccaatacgtgccatcaaatcccggttctattccatgttatttttcattttttctgttattttcggtgcgctctttgagatcctaggtattattatattgttcttttcacatcggattacttccctggcccacatcacctgtctcaccaacacgcaggccctagatttccctatagcaacagtaccttgcactacacgtctactatatcgagttacggctaatttcctctttctctctttttctattattattatgaataggctatttcttgaagggctagagaaatatgggcgtggcgactggcgcaacatctcgcgctggtcggtgaagacgcggactccgacgcaagtggcgagccatgcgcagaagttcttcatccgacaggccaacgccagcagccgtggcgactccaagcgtaagagcatccacgacatcactgccccatgatgtgtggtccgatcgaggatatgcattatgatccggtccagtctaggtttagttgtatttccatcaattccaactagctttcaaccccatttcaaagaggagagaacgaagggagtttagtcgtcggccctccctgttagttcctctctctgtgttgtgtaaaatatagctaggcaatagctaaaactaagcttggctggaacctgagatcaattgttgtgatactagtttgtgtacttgtcaaataatatttgtatccgtttaatttc</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001062206.1 RefSeq:Os05g0442400]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 5]]
[[Category:Chromosome 5]]

@@ Line 2: / Line 2: @@
 ==Annotated Information==
 In 1500bp upstream of the ATG start codon region，in addition to the basic core promoter acting element,there are some plants resist acting element processes related to abiotic stress , abscisic acid response elements , the light -inducible promoter acting elements , pathogens inducing factor acting elements , as well as root-specific binding sites.
 ===Evolution===
 Please input evolution information here.
 You can also add sub-section(s) at will.

@@ Line 2: / Line 2: @@
 ==Annotated Information==
 In 1500bp upstream of the ATG start codon region，in addition to the basic core promoter acting element,there are some plants resist acting element processes related to abiotic stress , abscisic acid response elements , the light -inducible promoter acting elements , pathogens inducing factor acting elements , as well as root-specific binding sites.
 ===Evolution===

← Older revision		Revision as of 11:08, 8 June 2014
Line 6:		Line 6:
	In 1500bp upstream of the ATG start codon region，in addition to the basic core promoter acting element,there are some plants resist acting element processes related to abiotic stress , abscisic acid response elements , the light -inducible promoter acting elements , pathogens inducing factor acting elements , as well as root-specific binding sites.		In 1500bp upstream of the ATG start codon region，in addition to the basic core promoter acting element,there are some plants resist acting element processes related to abiotic stress , abscisic acid response elements , the light -inducible promoter acting elements , pathogens inducing factor acting elements , as well as root-specific binding sites.

−	~~===Expression===~~
−	~~Please input expression information here.~~
	Rice seedling endogenous Os05g0442400 gene expression may be mainly in the roots,with the continuation of the rice germ , the rice husk expression region of rice endogenous Os05g0442400 gene increases from top to bottom , and reach the maximum expression of the area after heading .		Rice seedling endogenous Os05g0442400 gene expression may be mainly in the roots,with the continuation of the rice germ , the rice husk expression region of rice endogenous Os05g0442400 gene increases from top to bottom , and reach the maximum expression of the area after heading .

@@ Line 20: / Line 20: @@
 ==References==
 Please input cited references here.
 ==Structured Information==

@@ Line 8: / Line 8: @@
 ===Expression===
 Please input expression information here.
 ===Evolution===

@@ Line 22: / Line 22: @@
 ==Structured Information==
 [[Category:Genes]]
 [[Category:Japonica mRNA]]

@@ Line 4: / Line 4: @@
 ===Function===
 Please input function information here.
 ===Expression===

← Older revision		Revision as of 20:11, 22 July 2012
Line 1:		Line 1:
		+	Please input one-sentence summary here.
		+
		+	==Annotated Information==
		+	===Function===
		+	Please input function information here.
		+
		+	===Expression===
		+	Please input expression information here.
		+
		+	===Evolution===
		+	Please input evolution information here.
		+
		+	You can also add sub-section(s) at will.
		+
		+	==Labs working on this gene==
		+	Please input related labs here.
		+
		+	==References==
		+	Please input cited references here.
		+
		+	==Structured Information==
	{{JaponicaGene\|		{{JaponicaGene\|
	GeneName = Os05g0442400\|		GeneName = Os05g0442400\|