Os11g0639100 - Revision history

Rice2012: /* References */

2015-06-13T09:09:13Z

‎References

Lmw2015: /* Structured Information */

2015-06-12T04:28:29Z

‎Structured Information

Zhangzhang at 11:32, 23 May 2014

2014-05-23T11:32:27Z

Cydta: /* Evolution */

2014-05-23T09:55:36Z

‎Evolution

Cydta: /* References */

2014-05-23T09:52:24Z

‎References

Cydta: /* Evolution */

2014-05-23T09:51:44Z

‎Evolution

Cydta: /* Detection of callose deposition */

2014-05-23T09:46:46Z

‎Detection of callose deposition

Cydta: /* Evolution */

2014-05-23T09:46:33Z

‎Evolution

Cydta: /* References */

2014-05-23T09:42:00Z

‎References

Cydta: /* Expression */

2014-05-23T09:39:57Z

‎Expression

← Older revision		Revision as of 09:09, 13 June 2015
Line 64:		Line 64:
	[[Category:Japonica Chromosome 11]]		[[Category:Japonica Chromosome 11]]
	[[Category:Chromosome 11]]		[[Category:Chromosome 11]]
		+	== Structured Information ==

@@ Line 58: / Line 58: @@
 </references>
 [[Category:Genes]]
 [[Category:Japonica mRNA]]

@@ Line 4: / Line 4: @@
 This gene(''Pikh; Pi54; Pi54rh'') confers a high degree of resistance to diverse strains of the fungus Magnaporthe oryzae. The rice blast resistance gene Pi-kh has been isolated from the indica rice line Tetep showing resistance to different M. oryzae strains in the North-Western Himalayan region of India <ref name="ref4" />.
 ===Function===
-Pi54 (Pi-kh cloned from the rice line Tetep) confers broad spectrum resistance against geographically diverse strains of M. oryzae collected from various parts of India and the US <ref name="ref1" />. In order to develop sustainably successful blast-resistant rice lines, a comprehensive dissection of the reactions downstream of R–Avr interactions is highly desirable.The co-expression patterns of bacterial disease resistance genes and their transcriptional regulators in transgenic rice have indicated that the resistance genes trigger an immune response <ref name="ref2" />. The expression
+Pi54 (Pi-kh cloned from the rice line Tetep) confers broad spectrum resistance against geographically diverse strains of M. oryzae collected from various parts of India and the US <ref name="ref1" />. In order to develop sustainably successful blast-resistant rice lines, a comprehensive dissection of the reactions downstream of R–Avr interactions is highly desirable.The co-expression patterns of bacterial disease resistance genes and their transcriptional regulators in transgenic rice have indicated that the resistance genes trigger an immune response <ref name="ref2" />. The expression patterns of defence response genes involved in rice–M. oryzae interaction have been widely studied <ref name="ref3" />.
 [[File:Functional analysis of differentially regulated genes of.png]]<ref name="ref5" />
@@ Line 34: / Line 32: @@
 [[File:Structural components of Pi54 orthologues..png]]<ref name="ref7" />
- Structural components of Pi54 orthologues. '''a''' Nipponbare; '''b''' Tetep ; '''c''' O. rhizomatis and '''d'''
+Structural components of Pi54 orthologues. '''a''' Nipponbare; '''b''' Tetep ; '''c''' O. rhizomatis and '''d'''
 tertiary structure of PI54RH protein generated by homology modelling using Modeller module of Accelrys Discovery Studio Software. CC domain (sky blue), NBS domain (parrot green), LRR domains (violet) and Zn-finger domain (yellow), N indicates amino terminal and C indicates carboxy terminal of PI54RH protein.
-== Detection of callose deposition ==
+===Detection of callose deposition===
 To analyze this important aspect of defense response by the rice plants and understand about the possible involvement of Pi54 gene in the deposition of callose, 15 m thick transverse sections of leaf epidermis were prepared from the transgenic and non-transgenic plants after 0, 72, 96 and 120 hpi and stained with callose specific aniline blue stain. Stained sections were observed under fluorescent light microscope. Careful histochemical examination of these sections revealed the gradually increasing deposition of callose resulting into thickened cell walls in the plants of transgenic line TP-Pi54-2, which has earlier been found to be highly resistant to M. oryzae.<ref name="ref6" />
 [[File:Effect of blast inoculation on deposition of Callose and other.png]]<ref name="ref6" />
 ==Labs working on this gene==
-.National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute,India.
+# National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute,India.
-.Department of Biotechnology, Himachal Pradesh University, India.
+# Department of Biotechnology, Himachal Pradesh University, India.
 ==References==
@@ Line 60: / Line 56: @@
 * <ref name="ref6">Amit Kumar Rai;Satya Pal Kumar;Santosh Kumar Gupta;Naveen Gautam;Nagendera Kumar Singh;Tilak Raj Sharma. Functional complementation of rice blast resistance gene Pi-kh(Pi54) conferring resistance to diverse strains of Magnaporthe oryzae, Journal of Plant Biochemistry and Biotechnology, 2011, 20(1): 55-65</ref>
 * <ref name="ref7">Alok Das;D. Soubam;P. K. Singh;S. Thakur;N. K. Singh;T. R. Sharma. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae, Functional & Integrative Genomics, 2012, 12(2): 215-228</ref>
 ==Structured Information==

← Older revision		Revision as of 09:55, 23 May 2014
Line 31:		Line 31:

	Phylogenetic analysis of the Pi54rh with 19 blast resistance genes cloned from rice. Bootstrap values, corresponding to the match times of branching orders (1,000 replicates), are shown at the nodes of each branch point. The unit of branch length is 0.2 nucleotide substitutions per site, as indicated by a bar at the bottom left corner of the tree.		Phylogenetic analysis of the Pi54rh with 19 blast resistance genes cloned from rice. Bootstrap values, corresponding to the match times of branching orders (1,000 replicates), are shown at the nodes of each branch point. The unit of branch length is 0.2 nucleotide substitutions per site, as indicated by a bar at the bottom left corner of the tree.
		+
		+	[[File:Structural components of Pi54 orthologues..png]]<ref name="ref7" />
		+
		+	Structural components of Pi54 orthologues. '''a''' Nipponbare; '''b''' Tetep ; '''c''' O. rhizomatis and '''d'''
		+	tertiary structure of PI54RH protein generated by homology modelling using Modeller module of Accelrys Discovery Studio Software. CC domain (sky blue), NBS domain (parrot green), LRR domains (violet) and Zn-finger domain (yellow), N indicates amino terminal and C indicates carboxy terminal of PI54RH protein.

	== Detection of callose deposition ==		== Detection of callose deposition ==

@@ Line 54: / Line 54: @@
 * <ref name="ref5">Santosh Kumar Gupta;Amit Kumar Rai;Shamsher Singh Kanwar;Duni Chand;Nagendera Kumar Singh;Tilak Raj Sharma. The single functional blast resistance gene Pi54 activates a complex defence mechanism in rice, Journal of Experimental Botany, 2012, 63(2): 757-772</ref>
 * <ref name="ref6">Amit Kumar Rai;Satya Pal Kumar;Santosh Kumar Gupta;Naveen Gautam;Nagendera Kumar Singh;Tilak Raj Sharma. Functional complementation of rice blast resistance gene Pi-kh(Pi54) conferring resistance to diverse strains of Magnaporthe oryzae, Journal of Plant Biochemistry and Biotechnology, 2011, 20(1): 55-65</ref>
-* <ref name="ref7"></ref>
+* <ref name="ref7">Alok Das;D. Soubam;P. K. Singh;S. Thakur;N. K. Singh;T. R. Sharma. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae, Functional & Integrative Genomics, 2012, 12(2): 215-228</ref>
 ==Structured Information==

@@ Line 28: / Line 28: @@
 ===Evolution===
-Please input evolution information here.
+[[File:Phylogenetic analysis of.png]]<ref name="ref7" />
 == Detection of callose deposition ==

@@ Line 22: / Line 22: @@
 ===Expression===
-editing
+All the putative transformants (T0) were first screened for the presence of transgene by PCR. Genomic DNA was isolated from the leaves of putative transformants by using DNeasy Plant Mini Kit (QIAGEN, Cologne, USA) as per manufacturer’s instructions. Three primer sets were designed for the screening of transformants by PCR (Fig. 1a). The first pair of primer, CaPi-F: GAGGAGGTTTCCCGATATTAC and CaPi-R: GGTAGGTTCTCCAACCATTCTG was se-
 ===Evolution===