Difference between revisions of "Atp1"
| Line 1: | Line 1: | ||
{{Mitochondrion| | {{Mitochondrion| | ||
GeneName = atp1| | GeneName = atp1| | ||
| + | Annotated Information = protein coding; the gene of protein Atp1(ATP synthase F0 subunit 1).| | ||
Function = Involved in the synthesis of ATP| | Function = Involved in the synthesis of ATP| | ||
Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the | Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the | ||
rice mitochondrial atp1 gene is also regulated in different ways.| | rice mitochondrial atp1 gene is also regulated in different ways.| | ||
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | ||
| + | Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.| | ||
| + | References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445. | ||
| + | Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546. | ||
| + | Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804. | ||
| + | Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19. | ||
| + | Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334. | ||
| + | Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216. | ||
| + | Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407. | ||
| + | Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from< i> Camellia sinensis</i> related to selenium or sulfur metabolism and functional expression in< i> Escherichia coli</i>[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738. | ||
| + | Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415. | ||
| + | Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.| | ||
| + | |||
| + | Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1) | ||
Description = ATP synthase F0 subunit 1| | Description = ATP synthase F0 subunit 1| | ||
Version = GeneID:6450183| | Version = GeneID:6450183| | ||
Revision as of 12:03, 24 May 2014
| Gene Name |
atp1 |
|---|---|
| Description |
{{{Description}}} |
| Version |
GeneID:6450183 |
| Length |
1530 bp |
| Definition |
Oryza sativa Japonica Group atp1, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:352379..353908 |
| Sequence Coding Region |
352379..353908 |
| Genome Context |
<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq> |
| Gene Sequence |
<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica> |
| External Link(s) |
