Difference between revisions of "Os01g0274800"
(→Function) |
(→Function) |
||
| Line 3: | Line 3: | ||
==Annotated Information== | ==Annotated Information== | ||
===Function=== | ===Function=== | ||
| − | This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues.In addition, CSA is a Member of the Family of R2R3 MYB transcription Factors and is associated in vivo and in vitro with the promoter of MST8.CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development.Furthermore,CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice. | + | This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues. |
| + | In addition, CSA is a Member of the Family of R2R3 MYB transcription Factors and is associated in vivo and in vitro with the promoter of MST8.CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development. | ||
| + | Furthermore,CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice<ref name="ref1" />. | ||
===Expression=== | ===Expression=== | ||
Revision as of 12:37, 28 May 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues. In addition, CSA is a Member of the Family of R2R3 MYB transcription Factors and is associated in vivo and in vitro with the promoter of MST8.CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development. Furthermore,CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice[1].
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
- School of Life Science and Biotechnology, Shanghai Jiao Tong University.
- Department of Horticulture, Michigan State University.
- State Key Laboratory of Genetic Engineering, Institute of Plant Biology, Center for Evolutionary Biology, School of Life Sciences, Fudan University
- Department of Biology, Huck Institutes of the Life Sciences, Pennsylvania State University, University Park
- Department of Plant Production, Faculty of Bioscience Engineering, University of Ghent
References
Cite error: Closing </ref> missing for <ref> tag
Structured Information
| Gene Name |
Os01g0274800 |
|---|---|
| Description |
Conserved hypothetical protein |
| Version |
NM_001049255.1 GI:115435923 GeneID:4325181 |
| Length |
1665 bp |
| Definition |
Oryza sativa Japonica Group Os01g0274800, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 1:9566484..9568148 |
| Sequence Coding Region |
9566915..9567077,9567297..9567751 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008394:9566484..9568148 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008394:9566484..9568148 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>ggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaa</cdnaseq> |
| Protein Sequence |
<aaseq>GGSTSWTRGLTGGRSRRRRRSGSWRRTGRTATSGRSSPASSPAA PTTPSRTTGTSSWRAATASSPAPSAAASLPPPPPPPPPPPRRRRRRSPSSRSTTTTTG TRSSTAGTAAPPSPTSRPPPAPPTSPSAPAAPRPPPPPPRRRTSPAASTSAAAPKPPP TATPSPSSTSSASARHDYRRRPPVVVVYRKEGRKEAAKIKRSKPS</aaseq> |
| Gene Sequence |
<dnaseqindica>1072..1234#398..852#catccatccattccagcatttcttgaagcttgctgtggatcagagaggatggctcacgagatgatgggtggcttcttcggccatccgccgccgccgcctgcgacggcggcggtgggtgaggaggaggacgaggtggtggaggagacggaggagggtggccatggcggaggagttcaggggaagctttgcgcgaggggacactggcggccggcggaggacgccaagctcaaggacctcgtcgcgcagtacggcccccagaactggaacctcatcgccgagaagctcgacggcagatcaggtaagagctcctccatggcggtgggtgcaatgcccaagaacgacgcgcattgaaggtgtttgtgatgggatggcatggcagggaagagctgcaggctgaggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagagcacgccgcgcgcctcttcctcttccaccgccgcgtgccgcgcgcctcgcgtcgcggcggcggctgacacggtggcgttcttccccggtgcaggctacgacttcgccgccgccccgcacgccatggctcccgcggcggcgtccacgttcgcgccgagcgcgcgctccgccttctccgccccggcgggccgcggcgagccccccggcgccgtcgaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaaggttagagttagccaagaacaagactaggacgaggaggaggaggaggaacaagacgtgctcgaagctcatcaatggcgttctcaaccaaacaagttttttctgctgctgctgctgctgcaagctagcttagattattcagatgaagaacaataagaagaagatgtagtactagtaaactagtaatggtgtgtgcgtttggaaatcaacaagcttccatgccatgccatgcctcctctgttcatcgatttcttttttttatctctctcctctgtatgaacaagtagaagaagaagaagaacaaattaatccattgctctcgcagatggatcagcaacatcaagcattgccgcattgtctctctctttgtgttcattgtccatgacgccaaagagaaaagaagaaaaattttcattgctctgttcttgaaatc</dnaseqindica> |
| External Link(s) |
- ↑ Cite error: Invalid
<ref>tag; no text was provided for refs namedref1