Difference between revisions of "Os02g0799100"

From RiceWiki
Jump to: navigation, search
(Annotated Information)
Line 3: Line 3:
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Please input function information here.
+
Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments[1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1[2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition (Che et al., 2011).
  
 
===Expression===
 
===Expression===

Revision as of 15:01, 30 May 2014

Please input one-sentence summary here.

Annotated Information

Function

Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments[1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1[2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition (Che et al., 2011).

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information

Gene Name

Os02g0799100

Description

Hypothetical protein

Version

NM_001186253.1 GI:297721638 GeneID:9266998

Length

3610 bp

Definition

Oryza sativa Japonica Group Os02g0799100, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 2

Location

Chromosome 2:34917690..34921299

Sequence Coding Region

34920472..34920601,34920706..34920743,34920892..34921040,34921133..34921148

Expression

GEO Profiles:Os02g0799100

Genome Context

<gbrowseImage1> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>atggcggccgctgcaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggagaacgccaagttgcgtcatctgcttgctgagcgaaacaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattag</cdnaseq>

Protein Sequence

<aaseq>MAAAAGAAARGGGVIPAGKGGSLRSPGKPVVLADITNTGRPNPT GSVHAIADVLKENAKLRHLLAERNKVIEVSRVELQKIRLALQAMQQKNLQLVQANSQM FAVCLLIH</aaseq>

Gene Sequence

<dnaseqindica>699..828#557..594#260..408#152..167#tctccgaaacctcatcggattcctctccgcgcggctaccggagcgccgcctctctctccccgcgcgcgcgctgcggctccgagggtcctcgccggcttcacctccggcggtggcgtgcgcaaccacaggccccgcggccgctgggccagccatggcggccgctgcaggtaaaaatcgtatcccctagatttcgagctacccgtggcattccatggtggggttctctcgggctcagcttccgcacctcctcctaaaccaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggtgatttcagttctagctctattttttttttcttcgggggatttcggttctaactcaaacaagcagacaaccctagcagcgccaagttgaatgctagtaattccgatttccatccgattaaaccatttaattcctcccttgctttcaggagaacgccaagttgcgtcatctgcttgctgagcgaaagtatgcattgcctctaccatccattttgttgtcggaggataaaacctgcggtttctcaagtagcacagttttttttaaattattttttgctttcttatttgcagcaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattagctccctacctcaccattcttgtgtcaatgtttgtttatacttgtgcaatgctggttcaccaggcctgtaggttgagcacatagtttgagttatagctatgcataatggcaaatgagaagtgtttgtcttacttcattgctgattgttttgtggtagttacagactgtttgatatgtctatgttttcttcttccttgcaggaaataaatcaaggaaaagatagagtaagctgcctctggttctttgttgtttgaattttcaaatgcagtatgatttctgatttggggattaatctgtggatatgacatgcagatcaagttattgcaacatgaacttgcatgcacaatagccgtgctcaaagtaaagggttctgaactcgaggtaattctaaagcttgactgtatgaacctctgtttgttacatataacatgcttttctcatcgtctactattgcagaagatgagtaagacttctaacaatcaacaaaatagagcaaagatattggtatgcagtcaaattcttaagcaaatgattcaccatgtttagctgcattatttctagttctgaattctgaaatcgttctgttcgtgcaacataatcaggagaaaaaaaccaggtcttccaaatgcgcaccaactaaggctcatcaaatggctgcaggttctattagagaacatttggttgaaattcaatgtaatgctcactcttctcactatttctttcttgaactagatactatacctggcaatcgtttcatctatcctactttatggttataatttaccccctttatatgaagcaattgaagttttatgttttttcctctgccataagttaggacactagtaaaattctaatcttcatttgttgccaatttcttctcagcagctgtgccatcttatactagctgtcatgagcctccacaggataaaacaaacaagaggtattttcatctctttactgatgtttgagtgggtgactggttgaccgggttatagtagcctatttcatgcatcactacttattcagcatgtttgcaaacaggtgcacaaataggcggaagtcagaatcatgtgaagttacaatggataccaacacagtgcaacatagctgcagacctcatgtggaatataatgggtcatcgcatgatgatgatccaaggtaatcaatgcttaatgcttataacagaatgcgttcattgttgcatcattatctgatttaagcttgttcaaaactcttgggcacatgtggtcagaaaaactcgacggagaaggtctgccagattgaaccctggatcttttgaggtcgcagagatctgtgataaattgcatgaggatgctactgttccttcggctcctagttctaatgttccaaagctgcaggaaccaaatgctggaaaagatatggtagggttttactatttctttctgtttttctgtttcaaaaaaaatttcacaatgtggttatgattttgtgctagatttgtggtggcaagatgaagtcattgcaaaaagaacttccatgtgatgcaatagcgcaagtagtagaggctccagaactcaaggtaattgagcagagtggttcgcatcaaatttttgctagtcttacatatattaatttattttttagtaaaatctggatcctgattgtatgtactagaaaaaacgaagtatgcacacacaaaaggaagtgtatctggaggtgggcaggacagttcttatgtaaataatcctcacatttatccatgaagaagtcttaattcttattatgttcctacttctttcgtccaatgaaattaggagatacaagaagcaggttccagcgttgctggaggtgaggcgcataaatttgatattgaggatccagagccaccaaggtatggcacatcattttagcagggtttaagatgcatggtacatcacacaattcacctaaacaatatgctctgtccaatcagaaaatcaatgcgtattgatgcaaacaaacggaagctggaatcatttgagagtcgattggcctcgaacaaagaggactgcatcaatgccatatgcgactcaacttcaagcgtgccaattcagcatgaacaaaagaggtaactctctcctatattccaacgatgcactttcctctgcatggaacatgtcaatcatggctgcccttaatactgcagaaaattgtcaaggagaaaatcctcaagactggaccctggaccttgggaggtcacaaatggcacttttgaaattgtccaggaagatacagttgccccgtctgctccttccagttcaaatgctttgatcgagcagaccaaaaatgatatgcaaaacgaccgcagttgctcgactaaaccttctgacgagcaggtgataggtagaagatcttcagttgggaggccctcaagacgggcagcagaaaagatagtctcctacaaggaggtgcccttgaatattaagatgcgacgaccatgatccccacttgcatgcaaagagcacaaacaccattggcatttattttatggtgtagaatcaagtttgttgtgtatctatctgttttggtcgctgtcaataggtaggttagctcctctatctaccccaacatggatactcaccctgcatcccagtttcaaactgaccatggaatttatctgatttagcctcagtctggactgatgatgccgataacaaccagcaaaccattgttcctgttctgatgaagtagagaccagacaacaataatgtggttagtactgttttattttcttgatggttctcatatgttgagagatc</dnaseqindica>

External Link(s)

NCBI Gene:Os02g0799100, RefSeq:Os02g0799100