Difference between revisions of "Os11g0582500"

From RiceWiki
Jump to: navigation, search
(Function)
(Expression)
Line 6: Line 6:
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).
  
 
===Evolution===
 
===Evolution===

Revision as of 12:24, 1 June 2014

Please input one-sentence summary here.

Annotated Information

Function

The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

Expression

OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information

Gene Name

Os11g0582500

Description

Similar to Anther specific protein

Version

NM_001074690.1 GI:115486028 GeneID:4350790

Length

1584 bp

Definition

Oryza sativa Japonica Group Os11g0582500, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 11

Location

Chromosome 11:23859388..23860971

Sequence Coding Region

23859461..23859815,23860411..23860454

Expression

GEO Profiles:Os11g0582500

Genome Context

<gbrowseImage1> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>

Protein Sequence

<aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>

Gene Sequence

<dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>

External Link(s)

NCBI Gene:Os11g0582500, RefSeq:Os11g0582500