Difference between revisions of "Atp1"
Guo Xiaojia (talk | contribs) |
|||
| Line 2: | Line 2: | ||
GeneName = atp1| | GeneName = atp1| | ||
Annotated Information = protein coding; the gene of protein Atp1(ATP synthase F0 subunit 1).| | Annotated Information = protein coding; the gene of protein Atp1(ATP synthase F0 subunit 1).| | ||
| − | Function = Involved in the synthesis of ATP| | + | Function = Involved in the synthesis of ATP|This is one of the mitochondrial-encoded genes, which encodes one of the ATP sythases of the respiratory chain.Encode the αsubunit of F1. |
| − | Expression = | + | Expression = With the in vitro capping method, ribonuclease protection experiments and from primer extension analysis, it has been prove that rice atp1 is transcribed from multiple initiation sites.Further experiments prove that there are at least eight transcription initiation sites of the rice mitochondrial atp1 gene. This only exist in rice atp1 gene, which are different from other plant species, such as wheat , maize and ''Oenothera''. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the rice mitochondrial atp1 gene is also regulated in different ways.| |
| − | rice mitochondrial atp1 gene is also regulated in different ways.| | + | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|During the evolution peocess, the majarity of the mitochondria genetics content were transferred into the nucleus of the cell.Mitochondrial biogenesis today relies on the coordinated regulation of both the nuclear genomes and the mitochondrial genomes. So the expression of rice atp1 now is influence by bothe the nuclear genomes and the mitochondrial genomes. |
| − | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | + | Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|Laboratory of Radiation Genetics, Faculty of Agriculture, The University |
| − | Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.| | + | of Tokyo. Laboratory of Plant Breeding, Faculty of Agriculture, The University |
| + | of Tokyo. | ||
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445. | References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445. | ||
Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546. | Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546. | ||
| Line 17: | Line 18: | ||
Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415. | Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415. | ||
Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.| | Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.| | ||
| + | Mikio Nakazono, Mayuko Ishikawa, et al. Multiple initiation sites for transcription of a gene | ||
| + | for subunit 1 of F1-ATPase (atp1 ) in rice mitochondria[J]. Curr Genet, 1996, 29: 417-422. | ||
| + | Catherine Colas des Francs-Small, Ian Small. Surrogate mutants for studying mitochondrially encoded functions[J]. Biochimie, 2014, 234-242. | ||
| + | Kamel Hammani, Philippe Giege. RNA metabolism in plant mitochondria[J]. Trends in plant sciences, 2014, 19: 380-389. | ||
Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1) | Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1) | ||
Revision as of 09:30, 4 June 2014
| Gene Name |
atp1 |
|---|---|
| Description |
{{{Description}}} |
| Version |
GeneID:6450183 |
| Length |
1530 bp |
| Definition |
Oryza sativa Japonica Group atp1, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:352379..353908 |
| Sequence Coding Region |
352379..353908 |
| Genome Context |
<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq> |
| Gene Sequence |
<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica> |
| External Link(s) |
