Difference between revisions of "Orf25"
(→Evolution) |
(→References) |
||
| Line 16: | Line 16: | ||
==References== | ==References== | ||
| − | + | 1.Andrew W.Liu,Co-transcription of orf25 and coxllI in rice mitochondria, Curr Genet(1992)21:507-513; | |
{{Mitochondrion| | {{Mitochondrion| | ||
Revision as of 14:48, 5 June 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
ATP synthase in the plant mitochondrial endomembrane consists of F O and F1 parts and plays an important role in energy formation. As the intramembrane compartment of the enzyme, FO consisting of four subunits, orf25, orfB, atp6 and atp9, and functions as a transporter of H+ through the membrane. Changes in DNA sequence within the atp6 and atp9 genes, as well as in their upstream or downstream regions, were known to be closely related to male sterility in plants.
Expression
Southern hybridization analysis using homologous maize probes indicated that orf25 and coxIII are closely linked in the mitochondrial genome of rice (Oryza sativa) cultivar IR36. The two coding regions were found on the same 5.1 kb BamHI fragment, and this fragment was cloned, mapped and partially sequenced. Using probes for each gene derived from the rice clone, a 2.4 kb dicistronic mRNA transcript was found containing both orf25 and coxIII coding regions. Multiple 5' ends were identified by primer extension analysis and a double stem/loop structure was mapped to the 3' end. The orf25 coding region shares > 85% identity with orf25 sequences from maize, tobacco and wheat, suggesting that orf25 may code for a conserved protein product.
Evolution
The nucleotide sequence of orf25 gene is very conservative in plants.The rice orf25 nucleotide sequence shows a 97.0%, 93.5% and 85.2% identity to wheat (Bonen et al. 1990), maize (Stamper et al. 1987), and tobacco (Stamper et al. 1987), respectively.
Labs working on this gene
Andrew W.Liu, Department of Biological Sciences, Stanford University.
References
1.Andrew W.Liu,Co-transcription of orf25 and coxllI in rice mitochondria, Curr Genet(1992)21:507-513;
| Gene Name |
orf25 |
|---|---|
| Description |
hypothetical protein |
| Version |
GeneID:6450126 |
| Length |
594 bp |
| Definition |
Oryza sativa Japonica Group orf25, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:18402..18995 |
| Sequence Coding Region |
18402..18995 |
| Genome Context |
<gbrowseImage1> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MGLSSTDKKDRRNMLFAAILFICALSSKKILIYNEEMIVACCFIGFLIFSRKSLGKTFKETLDGRIESIQEELQQFFNPNEVILGESNEQQRLLRISLRICSAVVESLPTARCAPKCEKTVQALLCRNLNVKLATLLNAISSRRIRLQDDIVTGFHFSVSERFVSGSTFKASTVEQIREAFVPIDLIREGLIVLRKV</aaseq> |
| Gene Sequence |
<dnaseqindica>1..594#atgggattgagttcaacggataagaaggatagaagaaatatgctatttgctgctattccatctatttgtgcatcaagtccgaagaagatctcaatctataatgaagaaatgatagtagctcgttgttttataggctttctcatattcagtcggaagagtttaggtaagactttcaaagaaactctcgacgggagaatcgagtctattcaggaagaattgcagcaattcttcaatcctaacgaagtaattccgggggaatccaatgaacaacaacgattacttaggatcagcttgcgaatttgcagcgccgtagtagaatcattaccaacggcacgctgtgcgcctaagtgcgaaaagacagtgcaagctttgttatgccgaaacctaaatgtaaagtcagcaacacttctaaatgccacttcttcccgtcgcatccgtcttcaggacgatatagttacaggttttcacttttcagtgagtgaaagatttgtatccgggtctacgttcaaagcttctactgtagaacaaattcgagaggccttcgtacccatagacctaattcgggaaggcttgatagtcctaagaaaggtgtag</dnaseqindica> |
| External Link(s) |