Difference between revisions of "CL971152"
(→Function) |
(→Function) |
||
| Line 2: | Line 2: | ||
== Function == | == Function == | ||
| − | CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication | + | CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].It consistently decreased rice grain width in both the Asominori/IR24 RIL and CSSL populations with the geneticbackground Asominori.The major grain-widthQTL qGW-5 on chromosome 5 was consistently detectedin all eight environments including two cropping sea-sons (2001 and 2002) and four locations (Nanjing,Jinhu, Donghai, and Hainan in China), and the donorIR24 allele of qGW-5 had a significant and stable effecton decreasing rice grain width in the isogenic back-ground of Asominori (Wan et al. 2005)[2] GW5 is associated with rice domestication, and was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes , at a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1]. |
== Sequence == | == Sequence == | ||
Revision as of 12:42, 10 June 2014
Function
CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].It consistently decreased rice grain width in both the Asominori/IR24 RIL and CSSL populations with the geneticbackground Asominori.The major grain-widthQTL qGW-5 on chromosome 5 was consistently detectedin all eight environments including two cropping sea-sons (2001 and 2002) and four locations (Nanjing,Jinhu, Donghai, and Hainan in China), and the donorIR24 allele of qGW-5 had a significant and stable effecton decreasing rice grain width in the isogenic back-ground of Asominori (Wan et al. 2005)[2] GW5 is associated with rice domestication, and was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes , at a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].
Sequence
ATGGCAGGAGGAGCTGCACGAGCGGGCGGTGCAGCCGGCAACTTGGCGAGCGGGCAGAGG
AGGAGGGACGGGCGCCGGGGGAGGGAGCAGGCGGAGGAGGACGGAGCGGCATCGGGGGAG
GGAGCAGGAAGAGGAGGAGGGACGGACGCCGTGGGAGGGAGCAGACGGAGGAGGAGGAAC
GGGCGGCCAGTGGCGGAGCCGAGCAGGAGGCGGAAGGAGCTAATGCCATTCGCTCCATCA
AAGTGGGATGGATTAGTCCAGCCGATTTTGGCGGACCACCTCGTCCTGGATCTGGGAAGA
ATATTCCCATCTAGGATCATCCCGTCCTACACATCCCTCTACCCAAACAGCTCGAAAAAT
AGGATCGACCTAACCCATCTCATTCCATATCCCACTAACCAAACACAAGCTAAAAGTCTC
ACCCTAACCTTATAA
Reference
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.