Difference between revisions of "CL971152"
(Created page with " == Function == CL971152 encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. CL971152 represents a major QTL underlying rice width and weigh...") |
(→Function) |
||
| (11 intermediate revisions by 2 users not shown) | |||
| Line 2: | Line 2: | ||
== Function == | == Function == | ||
| − | + | CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].It consistently decreased rice grain width in both the Asominori/IR24 RIL and CSSL populations with the geneticbackground Asominori.The major grain-widthQTL qGW-5 on chromosome 5 was consistently detectedin all eight environments including two cropping sea-sons (2001 and 2002) and four locations (Nanjing,Jinhu, Donghai, and Hainan in China), and the donorIR24 allele of qGW-5 had a significant and stable effecton decreasing rice grain width in the isogenic back-ground of Asominori (Wan et al. 2005)[2] GW5 is associated with rice domestication, and was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes , at a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1]. | |
| + | [[File:riceone.png|200px|thumb|left|alt Phenotypic distri-butions of rice grain width inthe Asominori/IR24 recombi-nant inbred lines in four environ-ments (E1–E4).]] | ||
| + | [[File:ricethree.png|200px|thumb|left|alt Physical-to-genetic distance ratios in 10 markerintervals near the gw-5 gene.]] | ||
| + | |||
| + | == Sequence == | ||
| + | ATGGCAGGAGGAGCTGCACGAGCGGGCGGTGCAGCCGGCAACTTGGCGAGCGGGCAGAGG | ||
| + | AGGAGGGACGGGCGCCGGGGGAGGGAGCAGGCGGAGGAGGACGGAGCGGCATCGGGGGAG | ||
| + | GGAGCAGGAAGAGGAGGAGGGACGGACGCCGTGGGAGGGAGCAGACGGAGGAGGAGGAAC | ||
| + | GGGCGGCCAGTGGCGGAGCCGAGCAGGAGGCGGAAGGAGCTAATGCCATTCGCTCCATCA | ||
| + | AAGTGGGATGGATTAGTCCAGCCGATTTTGGCGGACCACCTCGTCCTGGATCTGGGAAGA | ||
| + | ATATTCCCATCTAGGATCATCCCGTCCTACACATCCCTCTACCCAAACAGCTCGAAAAAT | ||
| + | AGGATCGACCTAACCCATCTCATTCCATATCCCACTAACCAAACACAAGCTAAAAGTCTC | ||
| + | ACCCTAACCTTATAA | ||
| + | [http://www.ncbi.nlm.nih.gov/nucgss/52396942] | ||
| + | [[File:rice2.png|200px|thumb|left|alt Genetic andphysical maps of the gw-5gene on rice chromosome5. (A) QTL mapping ofthe qGW-5 locus. (B) SixBAC/PAC contigs aroundthe gw-5 locus. (C) Finemapping of gw-5 usingnewly developed SSRmarkers. The red super-script a indicates that thereare 167 recombinants ofthe total 805 homozygousplants between the gw-5gene and the markerRM5874. In fact, the 167 re-combinants included 113wide-grain plants with theheterozygous band patternsof wide- and narrow-grainparents and 27 wide-grainplants with the band pat-tern of the narrow-grainparent. The recombinationfrequency ? (N11 N2/2)/N, where N is the total num-ber of wide-grain plants sur-veyed, N1is the number ofwide-grain plants with the band pattern of the narrow-grain parent, and N2is the number of wide-grain plants with the hetero-zygous band patterns. We marked the number of recombinants between RM5874 and the gw-5 gene as 167 to directly calculate therecombination frequency, [(27 3 2 1 113 ? 167)/(805 3 2)] 3 100 (cM). The other numbers marked in the row (no. of re-combinants) were also calculated on the basis of this approach.]] | ||
==Reference == | ==Reference == | ||
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209. | 1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209. | ||
| + | 2.Xiangyuan, Wan. Quantitative Trait Loci (QTL) Analysis For Rice Grain Widthand Fine Mapping of an Identified QTL Allele gw-5 in aRecombination Hotspot Region on Chromosome 5[J]. Genetics Society of America, 2008, 10(1534): 2239-2252 | ||
Latest revision as of 13:51, 10 June 2014
Function
CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].It consistently decreased rice grain width in both the Asominori/IR24 RIL and CSSL populations with the geneticbackground Asominori.The major grain-widthQTL qGW-5 on chromosome 5 was consistently detectedin all eight environments including two cropping sea-sons (2001 and 2002) and four locations (Nanjing,Jinhu, Donghai, and Hainan in China), and the donorIR24 allele of qGW-5 had a significant and stable effecton decreasing rice grain width in the isogenic back-ground of Asominori (Wan et al. 2005)[2] GW5 is associated with rice domestication, and was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes , at a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].
Sequence
ATGGCAGGAGGAGCTGCACGAGCGGGCGGTGCAGCCGGCAACTTGGCGAGCGGGCAGAGG
AGGAGGGACGGGCGCCGGGGGAGGGAGCAGGCGGAGGAGGACGGAGCGGCATCGGGGGAG
GGAGCAGGAAGAGGAGGAGGGACGGACGCCGTGGGAGGGAGCAGACGGAGGAGGAGGAAC
GGGCGGCCAGTGGCGGAGCCGAGCAGGAGGCGGAAGGAGCTAATGCCATTCGCTCCATCA
AAGTGGGATGGATTAGTCCAGCCGATTTTGGCGGACCACCTCGTCCTGGATCTGGGAAGA
ATATTCCCATCTAGGATCATCCCGTCCTACACATCCCTCTACCCAAACAGCTCGAAAAAT
AGGATCGACCTAACCCATCTCATTCCATATCCCACTAACCAAACACAAGCTAAAAGTCTC
ACCCTAACCTTATAA
Reference
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209. 2.Xiangyuan, Wan. Quantitative Trait Loci (QTL) Analysis For Rice Grain Widthand Fine Mapping of an Identified QTL Allele gw-5 in aRecombination Hotspot Region on Chromosome 5[J]. Genetics Society of America, 2008, 10(1534): 2239-2252