Difference between revisions of "Os10g0542100"
Zhangyulong (talk | contribs) (→Annotated Information) |
Zhangyulong (talk | contribs) (→Labs working on this gene) |
||
| Line 10: | Line 10: | ||
==Labs working on this gene== | ==Labs working on this gene== | ||
| − | |||
| − | |||
==References== | ==References== | ||
Revision as of 14:49, 27 August 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
Plant MTs have been suggested to play important roles in maintaining the homoeostasis of essential transition metals, detoxification of toxic metals, and protecting against intercellular oxidative stress.
Expression
Evolution
Labs working on this gene
References
Gong-Ke Zhou;Yu-Feng Xu;Jin-Yuan Liu. Characterization of a rice class II metallothionein gene: Tissue expression patterns and induction in response to abiotic factors. Journal of Plant Physiology, 2005, 162(6): 686-696. Adams T, Saydam N, Steiner F, Schaffner W, Freedman J. Activation of gene expression by metal-responsive signal transduction pathways. Environ Health Perspect 2002;110:813–7. Akashi K, Nishimura N, Ishida Y, Yokota A. Potent hydroxyl radical-scavenging activity of drought-induced type-2 metallothionein in wild watermelon. Biochem Biophys Res Commun 2004;323:72–8. Bate N, Twell D. Functional architecture of a late pollen promoter: pollen-specific transcription is developmentally regulated by multiple stage-specific and codependent activator elements. Plant Mol Biol 1998; 37:859–69. Breusegem FV, Vranova E, Dat JF, Inze D. The role of active oxygen species in plant signal transduction. Plant Sci 2001;161:405–14. Busk PK, Pages M. Regulation of abscisic acid-induced transcription. Plant Mol Biol 1998;37:425–35. Chatthai M, Kaukinen KH, Tranbarger TJ, Gupta PK, Misra S. The isolation of a novel metallothionein-related cDNA expressed in somatic and zygotic embryos of Douglas-fir: regulation by ABA, osmoticum, and metal ions. Plant Mol Biol 1997;34:243–54. Cobbett CS. Phytochelatins and their roles in heavy metal detoxification. Plant Physiol 2000;123:825–32. Cobbett CS, Goldsbrough PB. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu Rev Plant Biol 2002;53:159–82. Coyle P, Philcox JC, Carey LC, Rofe AM. Metallothionein: the multipurpose protein. Cell Mol Life Sci 2002;59: 627–47. Ellerstrom M, Stalberg K, Ezcurra I, Rask L. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo andendosperm-specific transcription. Plant Mol Biol 1996;32:1019–27. Fujiwara T, Beachy RN. Tissue-specific and temporal regulation of a beta-conglycinin gene: roles of the RY repeat and other cis-acting elements. Plant Mol Biol 1994;24:261–72. Garcia-Hernandez M, Murphy A, Taiz L. Metallothioneins 1 and 2 have distinct but overlapping expression patterns in Arabidopsis. Plant Physiol 1998;118:387–97. Ghoshal K, Jacob ST. Regulation of metallothionein gene expression. Prog Nucl Acid Res Mol Biol 2001;66: 357–84. Giritch A, Ganal M, Stephan UW, Baumlein H. Structure, expression and chromosomal localisation of the metallothionein-like gene family of tomato. Plant Mol Biol 1998;37:701–14. Robinson NJ, Tommey AM, Kuske C, Jackson PJ. Plant metallothioneins. Biochem J 1993;295:1–10. Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE, Bleecker AB. A copper cofactor for the ethylene recptor ETR1 from Arabidopsis. Science 1999;283: 996–8. Rushmore TH, Morton MR, Pickett CB. The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. J Biol Chem 1991;266:11,632–9. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, second edition. New York: Cold Spring Harbor Laboratory Press; 1989. Sato M, Kondoh M. Recent studies on metallothionein: protection against toxicity of heavy metals and oxygen free radicals. Tohoku J Exp Med 2002;196:9–22.
Structured Information
| Gene Name |
Os10g0542100 |
|---|---|
| Description |
Plant EC metallothionein-like protein, family 15 protein |
| Version |
NM_001071727.1 GI:115483197 GeneID:4349263 |
| Length |
737 bp |
| Definition |
Oryza sativa Japonica Group Os10g0542100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 10:21623772..21624508 |
| Sequence Coding Region |
21623825..21623883,21623970..21624174 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>atggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctga</cdnaseq> |
| Protein Sequence |
<aaseq>MGCDDKCGCAVPCPGGTGCRCASSARSGGGDHTTCSCGDHCGCN PCRCGRESQPTGRENRRAGCSCGDSCTCASCGSTTTTAPAATT</aaseq> |
| Gene Sequence |
<dnaseqindica>54..112#199..403#actgtacagggtagtagatctttcgtacgttggagccggccggatcgacgaccatggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtacggcgatctggtcgcccttggcatcttggcgaccgtgaaaccaactgaacaattcaagtgtatgtccacgcgtgtgggtgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctgatccatccatccatgcgcccaaaaatgcccaacgagacgtgtttatacgtgtggttaagcgtgtgtacgtgcgccatgcttagtactcatagctgcttagctaaacagcacagctgataaataaaaagggcttgctgcttgagtcgagtcgtatcccgttgtctagttctggctagactcgcgcatcacgcatgcaacggacatggtgatacgcgagggatggagagttcggagttgggagacactgtgtactgcagtaccaggttgataagtgtgtctgtacttgtgtaaatatgttttacatgaataaaaaggttggtaactttgtcatgttt</dnaseqindica> |
| External Link(s) |