Difference between revisions of "Os10g0542100"

From RiceWiki
Jump to: navigation, search
(→‎Labs working on this gene)
(→‎References)
Line 12: Line 12:
  
 
==References==
 
==References==
−
Gong-Ke Zhou;Yu-Feng Xu;Jin-Yuan Liu. Characterization of a rice class II metallothionein gene: Tissue expression patterns and induction in response to abiotic factors. Journal of Plant Physiology, 2005, 162(6): 686-696.
 
−
Adams T, Saydam N, Steiner F, Schaffner W, Freedman J. Activation of gene expression by metal-responsive signal transduction pathways. Environ Health Perspect 2002;110:813–7.
 
−
Akashi K, Nishimura N, Ishida Y, Yokota A. Potent hydroxyl
 
−
radical-scavenging activity of drought-induced type-2
 
−
metallothionein in wild watermelon. Biochem Biophys
 
−
Res Commun 2004;323:72–8.
 
−
Bate N, Twell D. Functional architecture of a late pollen
 
−
promoter: pollen-specific transcription is developmentally
 
−
regulated by multiple stage-specific and codependent
 
−
activator elements. Plant Mol Biol 1998;
 
−
37:859–69.
 
−
Breusegem FV, Vranova E, Dat JF, Inze D. The role of
 
−
active oxygen species in plant signal transduction.
 
−
Plant Sci 2001;161:405–14.
 
−
Busk PK, Pages M. Regulation of abscisic acid-induced
 
−
transcription. Plant Mol Biol 1998;37:425–35.
 
−
Chatthai M, Kaukinen KH, Tranbarger TJ, Gupta PK, Misra
 
−
S. The isolation of a novel metallothionein-related
 
−
cDNA expressed in somatic and zygotic embryos of
 
−
Douglas-fir: regulation by ABA, osmoticum, and metal
 
−
ions. Plant Mol Biol 1997;34:243–54.
 
−
Cobbett CS. Phytochelatins and their roles in heavy metal
 
−
detoxification. Plant Physiol 2000;123:825–32.
 
−
Cobbett CS, Goldsbrough PB. Phytochelatins and metallothioneins:
 
−
roles in heavy metal detoxification and
 
−
homeostasis. Annu Rev Plant Biol 2002;53:159–82.
 
−
Coyle P, Philcox JC, Carey LC, Rofe AM. Metallothionein:
 
−
the multipurpose protein. Cell Mol Life Sci 2002;59:
 
−
627–47.
 
−
Ellerstrom M, Stalberg K, Ezcurra I, Rask L. Functional
 
−
dissection of a napin gene promoter: identification
 
−
of promoter elements required for embryo andendosperm-specific transcription. Plant Mol Biol
 
−
1996;32:1019–27.
 
−
Fujiwara T, Beachy RN. Tissue-specific and temporal
 
−
regulation of a beta-conglycinin gene: roles of the RY
 
−
repeat and other cis-acting elements. Plant Mol Biol
 
−
1994;24:261–72.
 
−
Garcia-Hernandez M, Murphy A, Taiz L. Metallothioneins 1
 
−
and 2 have distinct but overlapping expression patterns
 
−
in Arabidopsis. Plant Physiol 1998;118:387–97.
 
−
Ghoshal K, Jacob ST. Regulation of metallothionein gene
 
−
expression. Prog Nucl Acid Res Mol Biol 2001;66:
 
−
357–84.
 
−
Giritch A, Ganal M, Stephan UW, Baumlein H. Structure,
 
−
expression and chromosomal localisation of the
 
−
metallothionein-like gene family of tomato. Plant
 
−
Mol Biol 1998;37:701–14.
 
−
Robinson NJ, Tommey AM, Kuske C, Jackson PJ. Plant
 
−
metallothioneins. Biochem J 1993;295:1–10.
 
−
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE,
 
−
Bleecker AB. A copper cofactor for the ethylene
 
−
recptor ETR1 from Arabidopsis. Science 1999;283:
 
−
996–8.
 
−
Rushmore TH, Morton MR, Pickett CB. The antioxidant
 
−
responsive element. Activation by oxidative stress and
 
−
identification of the DNA consensus sequence required
 
−
for functional activity. J Biol Chem 1991;266:11,632–9.
 
−
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A
 
−
Laboratory Manual, second edition. New York: Cold
 
−
Spring Harbor Laboratory Press; 1989.
 
−
Sato M, Kondoh M. Recent studies on metallothionein:
 
−
protection against toxicity of heavy metals and oxygen
 
−
free radicals. Tohoku J Exp Med 2002;196:9–22.
 
  
 
==Structured Information==
 
==Structured Information==

Revision as of 14:49, 27 August 2014

Please input one-sentence summary here.

Annotated Information

Function

Plant MTs have been suggested to play important roles in maintaining the homoeostasis of essential transition metals, detoxification of toxic metals, and protecting against intercellular oxidative stress.

Expression

Evolution

Labs working on this gene

References

Structured Information

Gene Name

Os10g0542100

Description

Plant EC metallothionein-like protein, family 15 protein

Version

NM_001071727.1 GI:115483197 GeneID:4349263

Length

737 bp

Definition

Oryza sativa Japonica Group Os10g0542100, complete gene.

Source

Oryza sativa Japonica Group 

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 10

Location

Chromosome 10:21623772..21624508

Sequence Coding Region

21623825..21623883,21623970..21624174

Expression

GEO Profiles:Os10g0542100

Genome Context

<gbrowseImage1> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>atggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctga</cdnaseq>

Protein Sequence

<aaseq>MGCDDKCGCAVPCPGGTGCRCASSARSGGGDHTTCSCGDHCGCN PCRCGRESQPTGRENRRAGCSCGDSCTCASCGSTTTTAPAATT</aaseq>

Gene Sequence

<dnaseqindica>54..112#199..403#actgtacagggtagtagatctttcgtacgttggagccggccggatcgacgaccatggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtacggcgatctggtcgcccttggcatcttggcgaccgtgaaaccaactgaacaattcaagtgtatgtccacgcgtgtgggtgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctgatccatccatccatgcgcccaaaaatgcccaacgagacgtgtttatacgtgtggttaagcgtgtgtacgtgcgccatgcttagtactcatagctgcttagctaaacagcacagctgataaataaaaagggcttgctgcttgagtcgagtcgtatcccgttgtctagttctggctagactcgcgcatcacgcatgcaacggacatggtgatacgcgagggatggagagttcggagttgggagacactgtgtactgcagtaccaggttgataagtgtgtctgtacttgtgtaaatatgttttacatgaataaaaaggttggtaactttgtcatgttt</dnaseqindica>

External Link(s)

NCBI Gene:Os10g0542100, RefSeq:Os10g0542100

Retrieved from "https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0542100&oldid=184373"