Difference between revisions of "Os01g0839100"
| Line 1: | Line 1: | ||
| − | + | As a salt-responsive zinc finger protein gene, ''ZFP179'' was identified and subsequently cloned from rice seedlings<ref name="ref1"/><ref name="ref2"/>. | |
==Annotated Information== | ==Annotated Information== | ||
===Function=== | ===Function=== | ||
Please input function information here. | Please input function information here. | ||
| + | |||
| + | ===Mutation=== | ||
| + | |||
===Expression=== | ===Expression=== | ||
| Line 12: | Line 15: | ||
You can also add sub-section(s) at will. | You can also add sub-section(s) at will. | ||
| + | |||
| + | ===Knowledge Extension=== | ||
| + | |||
==Labs working on this gene== | ==Labs working on this gene== | ||
Revision as of 03:08, 2 January 2015
As a salt-responsive zinc finger protein gene, ZFP179 was identified and subsequently cloned from rice seedlings[1][2].
Contents
Annotated Information
Function
Please input function information here.
Mutation
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Knowledge Extension
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
Os01g0839100 |
|---|---|
| Description |
Conserved hypothetical protein |
| Version |
NM_001185713.1 GI:297720560 GeneID:9272517 |
| Length |
860 bp |
| Definition |
Oryza sativa Japonica Group Os01g0839100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 1:37757089..37757948 |
| Sequence Coding Region |
37757379..37757597 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>gcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctga</cdnaseq> |
| Protein Sequence |
<aaseq>ATPPRRRRRRPRGTGHASTSAPCAGSSSPWGRRSAATCAGTGAR RARRPSCSRTPTTRAAPPCRSRRSPCRT</aaseq> |
| Gene Sequence |
<dnaseqindica>291..509#tttttagctcgtcattaagagcgaaagaaagttacttggaattctttggtttgttgtaatgacaatcacgagagaagaagcggagagcaaggagatggagagcctacgggtgcacgccagcgcgctgctctcgctgtcgtcgcctgcagcgtcggcgtcgcagccgacgtcgtcgtcgtcgacgacggagggggtgttcgagtgcaagacgtgcagcaagcggttcccgtcgttccaggcgctgggcgggcaccggacgagccacacgcggctgcaggcgaagctgctgagcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctgaactacccgccgctggaggacgccggcgacggctcggagcctgagttacttaaccttcttgtataagttgcatcgatagatatacatgtgaattgaattggcgtctgtacatagatatggtggatggattctttaccaaatttgatcgaaaaaaagaactaaattttggagcgtgatgatcatagcatgtaagttgtaacaaatgattgttaactgtaagataggaattctattcatttgttctcttctgtacaaaattacaaataggttgattaattagttggtcggttgtggttgattctttgtaaaataccaatttactagtataaatatactgacagcttattgtttc</dnaseqindica> |
| External Link(s) |
