Difference between revisions of "Os01g0839100"
(→Function) |
|||
| Line 3: | Line 3: | ||
==Annotated Information== | ==Annotated Information== | ||
===Function=== | ===Function=== | ||
| − | + | The ''ZFP179'' gene containing a complete ORF of 516 bp was cloned by RT-PCR from total RNA prepared from rice seedlings. The predicted protein product of ''ZFP179'' comprises 171 amino acids with the calculated molecular mass of 17.95 kDa<ref name="ref1"/>. | |
| + | When plants suffer from salt stress, ''ZFP179(ZINC FINGER PROTEIN179)'' might either enhance the expression of stress-defence genes, such as ''OsP5CS'', ''OsProT'', and ''OsLEA3'', and the subsequent accumulation of free proline, soluble sugars, and Group 3 late embryogenesis abundant proteins through an ABA-dependent manner, or activate the expression of ''OsDREB2A'' through an ABA-independent pathway. Both types of response may increase the salt tolerance of plants. In addition, ''ZFP179'' may enhance ROS-scavenging activity to remove the toxic ROS in plants induced by salt stress. Also, ''ZFP179'' functions as a transcriptional activator in yeast. ''SERF1'' Is a Direct Regulator of ''MAP3K6'', ''MAPK5'',''DREB2A'', ''ZFP179'', and ''SERF1''<ref name="ref1"/><ref name="ref2"/>. | ||
===Mutation=== | ===Mutation=== | ||
Revision as of 03:09, 2 January 2015
As a salt-responsive zinc finger protein gene, ZFP179 was identified and subsequently cloned from rice seedlings[1][2].
Contents
Annotated Information
Function
The ZFP179 gene containing a complete ORF of 516 bp was cloned by RT-PCR from total RNA prepared from rice seedlings. The predicted protein product of ZFP179 comprises 171 amino acids with the calculated molecular mass of 17.95 kDa[1]. When plants suffer from salt stress, ZFP179(ZINC FINGER PROTEIN179) might either enhance the expression of stress-defence genes, such as OsP5CS, OsProT, and OsLEA3, and the subsequent accumulation of free proline, soluble sugars, and Group 3 late embryogenesis abundant proteins through an ABA-dependent manner, or activate the expression of OsDREB2A through an ABA-independent pathway. Both types of response may increase the salt tolerance of plants. In addition, ZFP179 may enhance ROS-scavenging activity to remove the toxic ROS in plants induced by salt stress. Also, ZFP179 functions as a transcriptional activator in yeast. SERF1 Is a Direct Regulator of MAP3K6, MAPK5,DREB2A, ZFP179, and SERF1[1][2].
Mutation
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Knowledge Extension
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
Os01g0839100 |
|---|---|
| Description |
Conserved hypothetical protein |
| Version |
NM_001185713.1 GI:297720560 GeneID:9272517 |
| Length |
860 bp |
| Definition |
Oryza sativa Japonica Group Os01g0839100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 1:37757089..37757948 |
| Sequence Coding Region |
37757379..37757597 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>gcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctga</cdnaseq> |
| Protein Sequence |
<aaseq>ATPPRRRRRRPRGTGHASTSAPCAGSSSPWGRRSAATCAGTGAR RARRPSCSRTPTTRAAPPCRSRRSPCRT</aaseq> |
| Gene Sequence |
<dnaseqindica>291..509#tttttagctcgtcattaagagcgaaagaaagttacttggaattctttggtttgttgtaatgacaatcacgagagaagaagcggagagcaaggagatggagagcctacgggtgcacgccagcgcgctgctctcgctgtcgtcgcctgcagcgtcggcgtcgcagccgacgtcgtcgtcgtcgacgacggagggggtgttcgagtgcaagacgtgcagcaagcggttcccgtcgttccaggcgctgggcgggcaccggacgagccacacgcggctgcaggcgaagctgctgagcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctgaactacccgccgctggaggacgccggcgacggctcggagcctgagttacttaaccttcttgtataagttgcatcgatagatatacatgtgaattgaattggcgtctgtacatagatatggtggatggattctttaccaaatttgatcgaaaaaaagaactaaattttggagcgtgatgatcatagcatgtaagttgtaacaaatgattgttaactgtaagataggaattctattcatttgttctcttctgtacaaaattacaaataggttgattaattagttggtcggttgtggttgattctttgtaaaataccaatttactagtataaatatactgacagcttattgtttc</dnaseqindica> |
| External Link(s) |
