Difference between revisions of "Os01g0839100"
(→Function) |
(→Mutation) |
||
| Line 7: | Line 7: | ||
===Mutation=== | ===Mutation=== | ||
| − | + | [[File: ZFP179 expression1.jpg|right|thumb|280px|'''Figure 1.'''''Effect of ZFP179 overexpression on salt tolerance in transgenic rice plants.(from reference <ref name="ref1"/>).'']] | |
| + | To study the physiological function of ''ZFP179'', transgenic rice plants that overexpressed ''ZFP179'' (ZFP179-ox plants) were generated. The effect of salt on the seedling development of the ''ZFP179'' overexpression (ZFP179-ox) lines was investigated. Homozygous transgenic lines, S1, S2, S5, and S6 of the T3 generation were used to measure their performance under salt stress(figure 1)<ref name="ref1"/>. | ||
===Expression=== | ===Expression=== | ||
Revision as of 03:22, 2 January 2015
As a salt-responsive zinc finger protein gene, ZFP179 was identified and subsequently cloned from rice seedlings[1][2].
Contents
Annotated Information
Function
The ZFP179 gene containing a complete ORF of 516 bp was cloned by RT-PCR from total RNA prepared from rice seedlings. The predicted protein product of ZFP179 comprises 171 amino acids with the calculated molecular mass of 17.95 kDa[1]. When plants suffer from salt stress, ZFP179(ZINC FINGER PROTEIN179) might either enhance the expression of stress-defence genes, such as OsP5CS, OsProT, and OsLEA3, and the subsequent accumulation of free proline, soluble sugars, and Group 3 late embryogenesis abundant proteins through an ABA-dependent manner, or activate the expression of OsDREB2A through an ABA-independent pathway. Both types of response may increase the salt tolerance of plants. In addition, ZFP179 may enhance ROS-scavenging activity to remove the toxic ROS in plants induced by salt stress. Also, ZFP179 functions as a transcriptional activator in yeast. SERF1 Is a Direct Regulator of MAP3K6, MAPK5,DREB2A, ZFP179, and SERF1[1][2].
Mutation
To study the physiological function of ZFP179, transgenic rice plants that overexpressed ZFP179 (ZFP179-ox plants) were generated. The effect of salt on the seedling development of the ZFP179 overexpression (ZFP179-ox) lines was investigated. Homozygous transgenic lines, S1, S2, S5, and S6 of the T3 generation were used to measure their performance under salt stress(figure 1)[1].
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Knowledge Extension
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
Os01g0839100 |
|---|---|
| Description |
Conserved hypothetical protein |
| Version |
NM_001185713.1 GI:297720560 GeneID:9272517 |
| Length |
860 bp |
| Definition |
Oryza sativa Japonica Group Os01g0839100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 1:37757089..37757948 |
| Sequence Coding Region |
37757379..37757597 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>gcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctga</cdnaseq> |
| Protein Sequence |
<aaseq>ATPPRRRRRRPRGTGHASTSAPCAGSSSPWGRRSAATCAGTGAR RARRPSCSRTPTTRAAPPCRSRRSPCRT</aaseq> |
| Gene Sequence |
<dnaseqindica>291..509#tttttagctcgtcattaagagcgaaagaaagttacttggaattctttggtttgttgtaatgacaatcacgagagaagaagcggagagcaaggagatggagagcctacgggtgcacgccagcgcgctgctctcgctgtcgtcgcctgcagcgtcggcgtcgcagccgacgtcgtcgtcgtcgacgacggagggggtgttcgagtgcaagacgtgcagcaagcggttcccgtcgttccaggcgctgggcgggcaccggacgagccacacgcggctgcaggcgaagctgctgagcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctgaactacccgccgctggaggacgccggcgacggctcggagcctgagttacttaaccttcttgtataagttgcatcgatagatatacatgtgaattgaattggcgtctgtacatagatatggtggatggattctttaccaaatttgatcgaaaaaaagaactaaattttggagcgtgatgatcatagcatgtaagttgtaacaaatgattgttaactgtaagataggaattctattcatttgttctcttctgtacaaaattacaaataggttgattaattagttggtcggttgtggttgattctttgtaaaataccaatttactagtataaatatactgacagcttattgtttc</dnaseqindica> |
| External Link(s) |
