Difference between revisions of "Os01g0839100"

From RiceWiki
Jump to: navigation, search
(Function)
(Mutation)
Line 7: Line 7:
  
 
===Mutation===
 
===Mutation===
 
+
[[File: ZFP179 expression1.jpg|right|thumb|280px|'''Figure 1.'''''Effect of ZFP179 overexpression on salt tolerance in transgenic rice plants.(from reference <ref name="ref1"/>).'']]
 +
To study the physiological function of ''ZFP179'', transgenic rice plants that overexpressed ''ZFP179'' (ZFP179-ox plants) were generated. The effect of salt on the seedling development of the ''ZFP179'' overexpression (ZFP179-ox) lines was investigated. Homozygous transgenic lines, S1, S2, S5, and S6 of the T3 generation were used to measure their performance under salt stress(figure 1)<ref name="ref1"/>.
  
 
===Expression===
 
===Expression===

Revision as of 03:22, 2 January 2015

As a salt-responsive zinc finger protein gene, ZFP179 was identified and subsequently cloned from rice seedlings[1][2].

Annotated Information

Function

The ZFP179 gene containing a complete ORF of 516 bp was cloned by RT-PCR from total RNA prepared from rice seedlings. The predicted protein product of ZFP179 comprises 171 amino acids with the calculated molecular mass of 17.95 kDa[1]. When plants suffer from salt stress, ZFP179(ZINC FINGER PROTEIN179) might either enhance the expression of stress-defence genes, such as OsP5CS, OsProT, and OsLEA3, and the subsequent accumulation of free proline, soluble sugars, and Group 3 late embryogenesis abundant proteins through an ABA-dependent manner, or activate the expression of OsDREB2A through an ABA-independent pathway. Both types of response may increase the salt tolerance of plants. In addition, ZFP179 may enhance ROS-scavenging activity to remove the toxic ROS in plants induced by salt stress. Also, ZFP179 functions as a transcriptional activator in yeast. SERF1 Is a Direct Regulator of MAP3K6, MAPK5,DREB2A, ZFP179, and SERF1[1][2].

Mutation

Figure 1.Effect of ZFP179 overexpression on salt tolerance in transgenic rice plants.(from reference [1]).

To study the physiological function of ZFP179, transgenic rice plants that overexpressed ZFP179 (ZFP179-ox plants) were generated. The effect of salt on the seedling development of the ZFP179 overexpression (ZFP179-ox) lines was investigated. Homozygous transgenic lines, S1, S2, S5, and S6 of the T3 generation were used to measure their performance under salt stress(figure 1)[1].

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Knowledge Extension

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information

Gene Name

Os01g0839100

Description

Conserved hypothetical protein

Version

NM_001185713.1 GI:297720560 GeneID:9272517

Length

860 bp

Definition

Oryza sativa Japonica Group Os01g0839100, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 1

Location

Chromosome 1:37757089..37757948

Sequence Coding Region

37757379..37757597

Expression

GEO Profiles:Os01g0839100

Genome Context

<gbrowseImage1> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>gcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctga</cdnaseq>

Protein Sequence

<aaseq>ATPPRRRRRRPRGTGHASTSAPCAGSSSPWGRRSAATCAGTGAR RARRPSCSRTPTTRAAPPCRSRRSPCRT</aaseq>

Gene Sequence

<dnaseqindica>291..509#tttttagctcgtcattaagagcgaaagaaagttacttggaattctttggtttgttgtaatgacaatcacgagagaagaagcggagagcaaggagatggagagcctacgggtgcacgccagcgcgctgctctcgctgtcgtcgcctgcagcgtcggcgtcgcagccgacgtcgtcgtcgtcgacgacggagggggtgttcgagtgcaagacgtgcagcaagcggttcccgtcgttccaggcgctgggcgggcaccggacgagccacacgcggctgcaggcgaagctgctgagcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctgaactacccgccgctggaggacgccggcgacggctcggagcctgagttacttaaccttcttgtataagttgcatcgatagatatacatgtgaattgaattggcgtctgtacatagatatggtggatggattctttaccaaatttgatcgaaaaaaagaactaaattttggagcgtgatgatcatagcatgtaagttgtaacaaatgattgttaactgtaagataggaattctattcatttgttctcttctgtacaaaattacaaataggttgattaattagttggtcggttgtggttgattctttgtaaaataccaatttactagtataaatatactgacagcttattgtttc</dnaseqindica>

External Link(s)

NCBI Gene:Os01g0839100, RefSeq:Os01g0839100

  1. 1.0 1.1 1.2 1.3 1.4 Cite error: Invalid <ref> tag; no text was provided for refs named ref1
  2. 2.0 2.1 Cite error: Invalid <ref> tag; no text was provided for refs named ref2