Difference between revisions of "BGIOSGA000971"

From RiceWiki
Jump to: navigation, search
 
(11 intermediate revisions by one other user not shown)
Line 3: Line 3:
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Please input function information here.
+
Multidrug and Toxic compound Extrusion proteins (MATE) are a family of secondary active transporters which utilize electrochemical gradient of membrane maintained by ATPases for their transport activity. Members of this transporter family have ubiquitous occurrence in all the organisms including human and plants. The first member of this family (NorM) was characterized from Vibriopara haemolyticus, which effluxes nofloxacin and ciprofloxacin outside of the cells in an energy dependent way. Most of the earlier studies suggest that MATE proteins act as an efflux pump that export majority of drugs and xenobiotic compounds outside the cell, and largely contribute to the drug resistance in bacteria. Recent reports indicate that MATE proteins function in antiport manner and drive the substrate transport in exchange with H+/Na+ depending on the organism. Studies suggest that H+ coupling is operational in plants, which is substituted by Na+ in bacteria. Though structure and mechanism of action of MATEs have not been studied in detail, recent investigations revealed conformation and transport behaviour of MATE proteins. Conversely to designated name “multidrug”, numerous studies revealed that MATE proteins have stringent substrate specificity and facilitate the movement of specific compounds. Presence of homologous putative MATEs has been identified from several organisms through comparative genomics. A genome wide scanning and analysis revealed that 58 MATE paralogues are present in Arabidopsis genome. In general, MATE proteins from various source organisms have a conserved domain and share at least 40% amino acid sequence homology.
 +
In higher plants, studies demonstrated that MATE proteins are mainly involved in the transport and trafficking of xenobiotic and small organic molecules. The foremost characterized Arabidopsis MATE protein, AtDTX1, was demonstrated to export norfloxacin due to its ability to restore drug tolerance in the norfloxacin sensitive bacterial mutant (kam3 mutant). Recently, evidences for role of MATEs in the plants are rapidly accumulating. Depending on the established functions of this gene family in plants, MATEs have been grouped into three major classes. The first group of the MATE has been demonstrated to be associated with disease resistance in Arabidopsis. Several Arabidopsis mutants have been identified and examined for understanding the molecular mechanism of pathogen resistance. Among them, enhanced disease susceptibility mutant (eds5) of Arabidopsis displayed a reduced basal resistance during pathogen interaction. The fine genetic mapping of the eds5 locus identified that EDS5, a member of the MATE transporter family, was localised within this locus, and substantially contributed to disease tolerance. The relation of EDS5 with disease tolerance has been explored very recently and demonstrated that EDS5 export salicylic acid (SA) outside chloroplast, where SA synthesis takes place. Similarly, ADS1 (activated disease susceptability1), a negative regulator for the disease resistance, was another MATE identified in Arabidopsis showing involvement during pathogen infection. A second group of MATE proteins is known for exporting small organic molecules such as citrate outside the cell which acts as a ligand molecule to bind aluminium (Al) in the rhizosphere. Unlike to other metals, Al toxicity is much pronounced in acidic soil and several genetic studies were performed to map the locus responsible for Al tolerance in plants. A locus for Al tolerance, AltSB, was identified that encode a MATE via positional cloning in sorghum. This SbMATE has been shown to efflux the citrate from cell and forming non-toxic complexes with Al in soil solution. Similar to sorghum, MATE proteins from Hordeum, Arabidopsis, Triticum and maize have been shown to participate in Al tolerance. Tandem duplication of MATE paralogues in the maize genome have been demonstrated to offer another level of transcriptional regulation to provide adaptation of maize to Al toxicity.
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
In order to investigate the function of OsMATE1 and OsMATE2, full-length cDNAs were expressed in Arabidopsis under
 +
control of a CaMV35S promoter. The presence and expression of transgene was confirmed through genomic and semiquantitative RTPCR. Depending upon relative expression and phenotypic appearance, three independent lines expressing OsMATE1 and OsMATE2 were selected for further study. Up to two weeks of germination in soil, growth pattern of the all transgenic lines was similar to WT plants. However, after two weeks of growth, transgenic lines expressing OsMATE1 or OsMATE2 displayed a distinguishable growth pattern in comparison to WT plants, but very similar to each other. The visible changes at the stage of three week old plants among all transgenic lines were quite prevalent that consist petiole length, leaf size and rosette leaf arrangement in vegetative parts.
 +
The pattern of rosette leaves of the mature plants was different in comparison to WT plants without any change in the number of leaves. Petiole length and rosette leaf size of the transgenic lines were significantly increased compared to the WT.Collectively, the expression of OsMATE1 and OsMATE2 resulted variation in vegetative tissues, including the leaf size and altered pattern of rosette development. To authenticate these inferences,growth of two T-DNA insertional mutants of Arabidopsis MATEs(SALK_045655C and SALK_124549C) having close sequence similarity with OsMATE1 and OsMATE2 were analysed. Interestingly, a cognate growth pattern of salk lines with WT plants was observed. Altogether, these observations suggest that OsMATE1 and OsMATE2 play important role in the growth and development of plants.
  
 
===Evolution===
 
===Evolution===
Please input evolution information here.
+
You can also add sub-section(s) at will.Another, third group of MATE transporters are involved in trafficking of secondary metabolites in vacuoles. Usually, vacuoles are the major repository site of most of the conjugated form of flavonoids comprising mainly flavonols, anthocyanins and flavone glycoside. The transport and storage of these flavonoides into vacuole are mediated by the different class of transporters on tonoplast. A member of MATE gene family (TT12) was elucidated for sequestration of proanthocyanidins in vacuoles of seed that leads to pigmentation of seed coat. The kinetic study of vesicles isolated from TT12 expressing yeast revealed that it can specifically transport glycosidic form like epicatechin 3′-O-glucoside and cyanidin 3-O glucoside. Consistent to the TT12, MATEs from Medicago and Vitis have been characterized for mobilization of flavonoids in cell organelles. Similar to the role in vacuolar flavonoids sequestration, MATE proteins are also recognised for alkaloids trafficking into vacuoles in tobacco.
 +
Apart from these functions FRD3, a MATE citrate efflux transporter, was shown to involved in Fe transport towards stele region and hence assisted in distribution of Fe throughout aerial parts in Arabidopsis. Curiously, one member of MATE gene family (Mdt1) was shown to regulate the glucose assimilation, and which is thought to be necessary for nutrient utilization, sporulation and pathogenicity in fungi. In an another report, role of a MATE-like transporter (ZRZ) has been demonstrated in organ initiation as overexpression of this MATE led to diverse morphological changes in Arabidopsis. Therefore, it seems that MATEs govern the diverse physiological functions in the plants which need to be elucidated. Likewise to Arabidopsis, genome-wide analysis of MATEs encoding loci in rice revealed the presence of large members of this gene family however, function of only a few members has been elucidated as yet. Our earlier study suggested that expression of some of the genes encoding MATEs is up-regulated in rice seedlings exposed to arsenic (As) stress. Of these loci, we have investigated the role of two gene, OsMATE1 (Os03g08900) and OsMATE2 (Os05g48040) using heterologous system, Arabidopsis, in this study. Our observations suggest that these MATEs play crucial role in plant growth, development and in stress responses.
  
You can also add sub-section(s) at will.
+
==Labs working on this gene==
 +
National Botanical Research Institute, Council of Scientific and Industrial Research (CSIR), Rana Pratap Marg, Lucknow-226 001, INDIA.
  
==Labs working on this gene==
+
Department of Botany, University of Lucknow, Lucknow-226007, INDIA.
Please input related labs here.
+
 
 +
The Scripps Research Institute,
  
 
==References==
 
==References==
Please input cited references here.
+
1.Kuroda, T. & Tsuchiya, T. Multidrug efflux transporters in the MATE family.Biochim Biophys Acta 1794, 763–768 (2009).
 +
 
 +
2.Morita, Y. et al. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrob Agents Chemother 42, 1778–1782 (1998).
 +
 
 +
3.Morita, Y. et al. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrob Agents Chemother 42, 1778–1782 (1998).
 +
 
 +
4.Lu, M. et al. Structures of a Na1-coupled, substrate-bound MATE multidrug transporter. Proc Natl Acad Sci U S A 110, 2099–2104 (2013).
 +
 
 +
5.Zhao, J. & Dixon, R. A. MATE transporters facilitate vacuolar uptake of epicatechin 39-O-glucoside for proanthocyanidin biosynthesis in Medicago truncatula and Arabidopsis. Plant Cell 21, 2323–2340 (2009).
 +
 
 +
6.Hvorup, R. N. et al. The multidrug/oligosaccharidyl-lipid/polysaccharide (MOP) exporter superfamily. Eur J Biochem 270, 799–813 (2003).
  
 
==Structured Information==
 
==Structured Information==
{{IndicaGene|
+
    [[Category:Genes]][[Category:Oryza Sativa Indica Group]][[Category:Indica Chromosome 1]]
GeneName = BGIOSGA000971|
 
Description = Multidrug resistance protein 4|
 
Definition = Oryza sativa Indica Group BGIOSGA000971, complete gene.|
 
tag = CM800|
 
tid = BGIOSGA000971-TA|
 
pid = BGIOSGA000971-PA|
 
Length = 6661|
 
Source = Oryza sativa Indica Group
 
 
 
  ORGANISM  Oryza sativa Indica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Indica Chromosome 1|Chromosome 1]]|
 
AP = Chromosome 1:32097824..32104484|
 
CDS = 32104215..32104484,32104074..32104128,32103051..32103226,32102551..32102772,32102214..32102452<br>,32100875..32101400,32100510..32100783,32099793..32100411,32099471..32099699<br>,32099090..32099356,32098738..32099001,32097824..32098468|
 
GCID = <gbrowseImage1>
 
name=IndicaChromosome01:32097824..32104484
 
source=RiceIndica01
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=IndicaChromosome01:32097824..32104484
 
source=RiceIndica01
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>ATGGACGAGTCAGGCAGAGGAACAGGTGATGATCATGCCCGGGAGACGAAGGATGCTGCGGCGGCGGCGTCGTCGTCGTCGGGGAAGAAGGTGCCGCTGTTCAGCTTGTTCCGGTACGCCGACCGCCTCGACGTGCTGCTGATGGTTGTCGGCACGGTGGGCGCGCTCGGCAACGGCATCTCGCAGCCCCTCATGACGGTCCTCTTCGGCAACGTCATCAACTCCTTCGGCGCGAACACCAGCGGCAGCGTCCTCCGCAGCGTGACCAAGGTTGTCCTCAACTTCATATATCTGGGAATTGGAACTTCAGTAGCTTCCTTTCTTCAGGTATCATGCTGGACTATGGCAGGAGAAAGGCAGTCTGCCCGCATCCGTTCTTTATACCTGAAAGCCGTTCTGAGGCAGGATATTACATTCTTCGACACAGAGATGACAACTGGTGAAGCAGTTTCTAGAATGTCTAGTGATACCCTCCTAATTCAAGGTGCTCTTGGTGAGAAGGGAGGGAAGCTTGTAGAACTGTTATCAAGCTTCATCGGTGGCTTTATCATAGCATTCACTAGAGGATGGCTTCTCACTCTTGTCATGCTAACATCGCTACCGTTAATTGCTATTGCCGGTGCAGTTTCTGCACAGGCCCTAACTAGAGTTTCTAGCAAGAGACAAACATCATATAGTGATGCTGGGGACACAGTTGAACAGACCATTGGATCTATAAGAACAGTTGTGTCCTTCAATGGTGAGAAGAAAGCGATAGCAATGTACCGTAATTTTATAAAGAAGTCATACAAGGCTACTATTGAGGAAGGCATTATCACTGGTTTTGGCATGGGCTCTGTCATGTGCGTCGTATTTGGCAGCTATGGATTAGCCTTCTGGTATGGTGGAAAGCTAATCATTGAGAAAGGTTACACAGGAGGAAAAATCATGACTATCTTGTTTGCCGTGTTGACCGGTGCATCCTCATTAGGCAATGCAACACCTGCAGTTGCTGCAGTTGTGGAAGGTCAATCTGCAGCATACAATTTGTTCAAAACAATTGAGAGGAAACCAGAGATAGATTCCGATGATAACAATGGCATGGTTTTAGAAGATATGAATGGCGATATTGAGCTAAAGGATGTGTACTTTCGTTACCCTGCAAGACCAGAGCAGTTGATATTGGATGGATTGTCGTTACAAGTAGCGAGTGGAACAACAATGGCTATAGTCGGAGAGAGTGGAAGCGGAAAGTCAACTGTTATCAGCCTAGTCGAAAGATTCTACGATCCACAGTCTGGCGAAGTTTTAATAGATGGAATTAGCATCAAGAAACTGAGACTTGATTGGATAAGAGGGAAGATCGGTCTTGTTAGCCAAGAGCCTCTGCTTTTTATGGCCTCCATTAAAGATAACATAATATATGGTAAAAAAGATGCAACGCTTGAAGAGATCAAGAGAGCAGCGGAGCTTGCAAATGCAGCTAACTTCATTGACAAGTTACCAAATGGTTATGATACTTTAGTTGGCCAGCGCGGTACTCAGCTCTCTGGAGGACAAAAACAGAGAATTGCAATTGCAAGAGCCATCCTCAAAGATCCAAAAATCCTTTTGCTCGATGAAGCAACAAGTGCACTTGATGTGGAGTCTGAGAGGATAGTTCAGGAGGCACTAAATAGAATGATGGTAGAAAGAACCACACTCGTTGTCGCTCATCGTTTGAGCACTGTGAGGAATGTTGATTGCATCACAGTCGTCCGCAAAGGAAAAATAGTTGAACAAGGTCCTCATGATGCACTGGTGAAGGATCCCGATGGAGCTTACTCCCAGCTAATTAGGCTACAAGAGACTCATCGTGATGAAAGGCATAAACTACCAGATTCCAGATCAAAAAGTACTAGTTTGTCATTCAGACGATCAAGAACTAAAGATTTTCTCAGCAAGAGCAACAGGTATTCCTTCAAGAGCCCCTTAGGATTGCCTGTTGATATACATGAGGATGGAATGACAAGCGAACAACAAAAGGTTGACCACTCTGACAGTAAGGCCATTAAAAAAACACCATTTGGACGGCTTTTTAATCTTAATAAGCCAGAAGTGCCAGTTCTTTTGTTAGGTTCTATAGCAGCATCAGTGCATGGAGTCATTTTGCCACTATACGGTATAATAATGCCAGGTGTTCTAAAATCATTCTATGAACCGCCAGATCAGCTGCGAAAAGATTCTAGATTTTGGGCATTGATGTCTGTTGTTCTGGGGGTTGCTTGTTTGATTTCAATCCCAGCAGAATATTTTTTGTTTGGAATTGCTGGGGGAAAGCTTATACAGCGTGTCCGTACACTGTCATTTCAAAGAATTATGCACCAAGAGGTTGCTTGGTTTGATAAGCCCTCCAATTCCAGTGGGGCACTTGGTACAAGGCTCTCAGTCGATGCGTTGAATGTCCGCCGTTTAGTAGGAGATAACCTGGCCCTTATAGTCCAGGCTGTAGCTACACTAACCACTGGCTTTGCCATAGCTTTTGCGGCAGATTGGAGGCTTGCACTGATCATCACTTGTGTAATTCCTTTAGTGGGTGCACAGGGCTATGCTCAAGTTAAGTTCTTGAAGGGGTTCAGTGAAGAATCTAAGGAGATGTATGAGGATGCAAACCAAGTTGCGGCTGACGCTGTAGGCAGCATCAGAACTGTAGCATCTTTCTGTTCAGAGAAAAGAGTGGTGGCAATATACAACAAGAAATGTGAAGCTTTAAGAAAACAGGGAATTCGAAGCGGAATCGTTGGAGGGATTGGCTTAAGTTTCTCAAACTTGATGTTATATCTGACTTACGGTCTTTGCTTCTATGTTGGTGCAAAGTTCGTAAGTCAGGGAAAAACTACTTTTTCAGATGTTTTCAAAGTTTTCTTTGCTTTAGTTTTGGCAGCCGTTGGTGTTTCGCAGTCAAGTGCATTGTCTACTAATGCAACAAAGGCAAGGGATTCTGCCATTTCCATTTTTAGTATTATCGATCGGAAGTCTAGGATTGATTCAAGTAGCGACGAGGGAGCGATAATGGAAAACGTCACTGGCAGCATTGATTTCAATAATGTCAGTTTCAAGTACCCATCACGCCCTGATGTTCAAATATTCAGTGACTTTACCTTGCACATTCCTTCCCAAAAGACCATAGCACTTGTTGGAGAAAGCGGTAGTGGGAAATCCACGATAATTGCTTTATTAGAGCGTTTCTATGATCCTGATTCTGGTAATATCTCACTAGATGGAGTTGAAATTAGAAGCTTAAAAGTCAGCTGGTTGAGGGATCAGATGGGGCTTGTAGGCCAGGAGCCAGTGCTTTTCAACGACACAATCCGTGCCAACATAACATACGGGAAACACAGTGAGGTAACAGAGGAAGAGATCACTGCTGTGGCCAAGGCAGCAAACGCCCATGAGTTCGTATCAAGCCTGCCACAAGGATACGACACAGTGGTAGGTGAGAAAGGGGTGCAACTATCTGGTGGGCAAAAACAGAGGGTAGCAATTGCAAGGGCCATCCTAAAGGACCCTAAGATACTGCTACTTGATGAGGCAACCAGTGCTCTAGATGCAGAATCAGAACGTGTTGTTCAAGATGCATTGGATCGAGTCATGGTCAACAGGACTACCATTGTAGTGGCACACCGCCTCTCCACAATCAAAGGGGCTGATATGATTGCAGTCCTCAAGGAAGGAAAAATTGCAGAAAAAGGAAAGCATGAAGCACTATTGCGGATCAAGGATGGTGCATATGCTTCACTTGTACAACTCCGCTCTAATTCCGAGTAA</cdnaseq>|
 
AA = <aaseq>MDESGRGTGDDHARETKDAAAAASSSSGKKVPLFSLFRYADRLDVLLMVVGTVGALGNGISQPLMTVLFGNVINSFGANTSGSVLRSVTKVVLNFIYLGIGTSVASFLQVSCWTMAGERQSARIRSLYLKAVLRQDITFFDTEMTTGEAVSRMSSDTLLIQGALGEKGGKLVELLSSFIGGFIIAFTRGWLLTLVMLTSLPLIAIAGAVSAQALTRVSSKRQTSYSDAGDTVEQTIGSIRTVVSFNGEKKAIAMYRNFIKKSYKATIEEGIITGFGMGSVMCVVFGSYGLAFWYGGKLIIEKGYTGGKIMTILFAVLTGASSLGNATPAVAAVVEGQSAAYNLFKTIERKPEIDSDDNNGMVLEDMNGDIELKDVYFRYPARPEQLILDGLSLQVASGTTMAIVGESGSGKSTVISLVERFYDPQSGEVLIDGISIKKLRLDWIRGKIGLVSQEPLLFMASIKDNIIYGKKDATLEEIKRAAELANAANFIDKLPNGYDTLVGQRGTQLSGGQKQRIAIARAILKDPKILLLDEATSALDVESERIVQEALNRMMVERTTLVVAHRLSTVRNVDCITVVRKGKIVEQGPHDALVKDPDGAYSQLIRLQETHRDERHKLPDSRSKSTSLSFRRSRTKDFLSKSNRYSFKSPLGLPVDIHEDGMTSEQQKVDHSDSKAIKKTPFGRLFNLNKPEVPVLLLGSIAASVHGVILPLYGIIMPGVLKSFYEPPDQLRKDSRFWALMSVVLGVACLISIPAEYFLFGIAGGKLIQRVRTLSFQRIMHQEVAWFDKPSNSSGALGTRLSVDALNVRRLVGDNLALIVQAVATLTTGFAIAFAADWRLALIITCVIPLVGAQGYAQVKFLKGFSEESKEMYEDANQVAADAVGSIRTVASFCSEKRVVAIYNKKCEALRKQGIRSGIVGGIGLSFSNLMLYLTYGLCFYVGAKFVSQGKTTFSDVFKVFFALVLAAVGVSQSSALSTNATKARDSAISIFSIIDRKSRIDSSSDEGAIMENVTGSIDFNNVSFKYPSRPDVQIFSDFTLHIPSQKTIALVGESGSGKSTIIALLERFYDPDSGNISLDGVEIRSLKVSWLRDQMGLVGQEPVLFNDTIRANITYGKHSEVTEEEITAVAKAANAHEFVSSLPQGYDTVVGEKGVQLSGGQKQRVAIARAILKDPKILLLDEATSALDAESERVVQDALDRVMVNRTTIVVAHRLSTIKGADMIAVLKEGKIAEKGKHEALLRIKDGAYASLVQLRSNSE</aaseq>|
 
DNA = <dnaseqindica>1..270#357..411#1259..1434#1713..1934#2033..2271#3085..3610#3702..3975#4074..4692#4786..5014#5129..5395#5484..5747#6017..6661#ATGGACGAGTCAGGCAGAGGAACAGGTGATGATCATGCCCGGGAGACGAAGGATGCTGCGGCGGCGGCGTCGTCGTCGTCGGGGAAGAAGGTGCCGCTGTTCAGCTTGTTCCGGTACGCCGACCGCCTCGACGTGCTGCTGATGGTTGTCGGCACGGTGGGCGCGCTCGGCAACGGCATCTCGCAGCCCCTCATGACGGTCCTCTTCGGCAACGTCATCAACTCCTTCGGCGCGAACACCAGCGGCAGCGTCCTCCGCAGCGTGACCAAGGTGAGTGCCCGCGGGCGCTTAGTGATACGCGATGGAGACACACCGGCCGGTAGCCAAATTAACTTTGGATCTTCTTTCTCCTCCAGGTTGTCCTCAACTTCATATATCTGGGAATTGGAACTTCAGTAGCTTCCTTTCTTCGTAAGTAAAAGTCCTTTCTCTGATTGGAACACCTCTTTAGTGAAGTAGAGAGAAGCTCCTGCCCTTTTCGCTGAAAAAAACAAAGAAAAAAAAAGAATTAGTGGAACCTGTAGCTTCAAATTATGGATGTGAAACATATAAATAGTATTCAGCAAGGGAATTTGTAGTAAACAGTATTAGAAATTCTTTCAATATCTAATTTGTTCCTATTATTCAATGAGTCTCCGGGTATCCATAAGTCAATAAGAAATTTCATTTAAAGGGTCTCAGAGTATCCATCAGATTCCAAAGCAAAATTAACACTTTTTATTCAAAGGGTCTCAGTATCCATAAGTCAGTAAGAAATTTTGTAGGATAGTGTGAAATTAGGCTTTGTTTGGTAAATGGGATTGAGAAATAATATCCCACCCTCCAAAAGGTAATATTGCATCCTAGCTATCCATTCTTCACACCTCATTTAATCCTAGCCATTTATTCTTTACACCTCATTTAATCCTAGTCATTCATCCATTTCCATTTCCCAATCCCACCTGCCATATCCCATTTGCCAAACACACCCTTAGGATAAGTAATTAATTTGCTCTTGCATGGATGCGCAATCACCAATACATAATATTCATTATTAACATCATGGTTGTCAGTTGTTACTACATGTTAGAATTCGGTTATTCTCAACTGTGATACACTAACACAGTATAAACATCATCATGCACTTATCCGGTGAGAAGTACCAAATGCGTTCCCTAACCATATAATCCTCAGCATCTTCGATCTAATCTGTTCGGTTAAATATATCACATGCTAATGGTACAACTGCCAGTAAAAAACTCACCTTAATTTGTCCCAGAGGTATCATGCTGGACTATGGCAGGAGAAAGGCAGTCTGCCCGCATCCGTTCTTTATACCTGAAAGCCGTTCTGAGGCAGGATATTACATTCTTCGACACAGAGATGACAACTGGTGAAGCAGTTTCTAGAATGTCTAGTGATACCCTCCTAATTCAAGGTGCTCTTGGTGAGAAGGTACTAAATACCTAGTAGCTCCCTTGTAAGGAACATACTATTTTTTATTAAATTGCTACTGAAAAAAAAAAACATATATTTTCATCACAGTGCAAACAAAAGTGTGGATAGACACAAGTTGATGGCAGGCATAATTATTTGCATATTTAGGAAGATATATCAAACGGATATAGTTATCATATTTACTAACTGTATTATTTCATATATTCAGGCAGTAAGTTGCACCTTGTGCTACTGTTGCTGATGTGTTCTTGGATTTTTAATCTTAACCTTTACAGGGAGGGAAGCTTGTAGAACTGTTATCAAGCTTCATCGGTGGCTTTATCATAGCATTCACTAGAGGATGGCTTCTCACTCTTGTCATGCTAACATCGCTACCGTTAATTGCTATTGCCGGTGCAGTTTCTGCACAGGCCCTAACTAGAGTTTCTAGCAAGAGACAAACATCATATAGTGATGCTGGGGACACAGTTGAACAGACCATTGGATCTATAAGAACAGTGAGTTTCACATATTTATATGAATTGTTTAATGCTATAACACACTTCTTTTTTTGGAGTAGCAGACAGTAAGTTTGATAAATATCCTGTGTTAACAGGTTGTGTCCTTCAATGGTGAGAAGAAAGCGATAGCAATGTACCGTAATTTTATAAAGAAGTCATACAAGGCTACTATTGAGGAAGGCATTATCACTGGTTTTGGCATGGGCTCTGTCATGTGCGTCGTATTTGGCAGCTATGGATTAGCCTTCTGGTATGGTGGAAAGCTAATCATTGAGAAAGGTTACACAGGAGGAAAAATCATGACTATCTTGTTTGCCGTGTTGACCGGTGCATCGTAAGTTTCAGCAAATCCTCCACTGTTGATATCAAAATACATGCTGTTTAGTGCACTACAATAATGAACCCCCAATCTATTCATGTATTATTTGGATTGATGGAAATATAACAAGAAATTTATATATATTACCTCAAAATCAAGAAGGCTGGTTAGCATGCAATTTTAGAAGTGCAAATGGCAGTTTTGTTCATTTCTCAGGTGTTTTTTAGAAAACTTCTCAGGATTTCAAGATGATTTTCAGAATTACCTTAAATTATTTTCAATATTTTCTTGATTACTATTTACAAAAAGACAATGCTAATTGCCAATGCATGAAAGTAACTTGTTTCTTGTAAACAGAATGGAATGAACTTAAAGTTTGATGGTCAAGTCAATTGCTTGACTATACATAATCCCTAGGCCCTATTACCATTTTAGGCAGACATACCAATTGCTAAGGAGTAGTTATTAATTCCAGTTAGTAAAAGGGGATCATGAACTGAGATATAGACATAAGTACCTAATAGCTAAATCAAGGTATCCTTAGCAATTGCAAGAGCAGGTTTAATCAATATGTTCTGCGCTAACAGGAGAAGTAGACAAACGCTAGGCTTTTGGAATCGTCACGAAGAGAATATTCTCCTGAGAAGTACATTACATGTTATATGCAAACGATTGCATTGGGTTTCACTGCTTTACCTACATTACTTGCTATTTCTCCTAAAATCACATTAAAGTTGAAAGATTTACAACAAAATAGCCATTAAAATTTTATCATTTGATATGGTATATAATGTTCTGAACATGGCACTTTCCAATTGTTTGTGACAGCTCATTAGGCAATGCAACACCTGCAGTTGCTGCAGTTGTGGAAGGTCAATCTGCAGCATACAATTTGTTCAAAACAATTGAGAGGAAACCAGAGATAGATTCCGATGATAACAATGGCATGGTTTTAGAAGATATGAATGGCGATATTGAGCTAAAGGATGTGTACTTTCGTTACCCTGCAAGACCAGAGCAGTTGATATTGGATGGATTGTCGTTACAAGTAGCGAGTGGAACAACAATGGCTATAGTCGGAGAGAGTGGAAGCGGAAAGTCAACTGTTATCAGCCTAGTCGAAAGATTCTACGATCCACAGTCTGGCGAAGTTTTAATAGATGGAATTAGCATCAAGAAACTGAGACTTGATTGGATAAGAGGGAAGATCGGTCTTGTTAGCCAAGAGCCTCTGCTTTTTATGGCCTCCATTAAAGATAACATAATATATGGTAAAAAAGATGCAACGCTTGAAGAGATCAAGAGAGCAGCGGAGCTTGCAAATGCAGCTAACTTCATTGACAAGTTACCAAATGTAAGAAAGGAAAAACTGAATGCTCCAAGTTCTCAAATTTAATTGTATATTAATGAAATAATCAGCTAACAATGTTTTCATGTCATACCAGGGTTATGATACTTTAGTTGGCCAGCGCGGTACTCAGCTCTCTGGAGGACAAAAACAGAGAATTGCAATTGCAAGAGCCATCCTCAAAGATCCAAAAATCCTTTTGCTCGATGAAGCAACAAGTGCACTTGATGTGGAGTCTGAGAGGATAGTTCAGGAGGCACTAAATAGAATGATGGTAGAAAGAACCACACTCGTTGTCGCTCATCGTTTGAGCACTGTGAGGAATGTTGATTGCATCACAGTCGTCCGCAAAGGAAAAATAGTTGAACAAGGTTGAATTAACTTGAAATGCACTGTTTTTCTATTATAGAAAATTTCTGCGGTCAACCTTAAATGATTCATTATACCAAAACATGTCCTGCGTACACAGGTCCTCATGATGCACTGGTGAAGGATCCCGATGGAGCTTACTCCCAGCTAATTAGGCTACAAGAGACTCATCGTGATGAAAGGCATAAACTACCAGATTCCAGATCAAAAAGTACTAGTTTGTCATTCAGACGATCAAGAACTAAAGATTTTCTCAGCAAGAGCAACAGGTATTCCTTCAAGAGCCCCTTAGGATTGCCTGTTGATATACATGAGGATGGAATGACAAGCGAACAACAAAAGGTTGACCACTCTGACAGTAAGGCCATTAAAAAAACACCATTTGGACGGCTTTTTAATCTTAATAAGCCAGAAGTGCCAGTTCTTTTGTTAGGTTCTATAGCAGCATCAGTGCATGGAGTCATTTTGCCACTATACGGTATAATAATGCCAGGTGTTCTAAAATCATTCTATGAACCGCCAGATCAGCTGCGAAAAGATTCTAGATTTTGGGCATTGATGTCTGTTGTTCTGGGGGTTGCTTGTTTGATTTCAATCCCAGCAGAATATTTTTTGTTTGGAATTGCTGGGGGAAAGCTTATACAGCGTGTCCGTACACTGTCATTTCAAAGAATTATGCACCAAGAGGTTGCTTGGTTTGATAAGCCCTCCAATTCCAGGTGCGCTACTCTAATGTACTTTTGCTATTTTATCTTTTATAAAAAAATATTTACATTTAAACCAATGCTAAGAGGCCATCTTATTTCTTACAGTGGGGCACTTGGTACAAGGCTCTCAGTCGATGCGTTGAATGTCCGCCGTTTAGTAGGAGATAACCTGGCCCTTATAGTCCAGGCTGTAGCTACACTAACCACTGGCTTTGCCATAGCTTTTGCGGCAGATTGGAGGCTTGCACTGATCATCACTTGTGTAATTCCTTTAGTGGGTGCACAGGGCTATGCTCAAGTTAAGTTCTTGAAGGGGTTCAGTGAAGAATCTAAGGTGACACATTACAGCTTACAACTGTAAAAATTGCTTGCTGTTTTATTGAGAATGATCTAGACAAGTGATCTAGAATTAAATTGATTGCCATTATAATGGGATCTCATTATACAGGAGATGTATGAGGATGCAAACCAAGTTGCGGCTGACGCTGTAGGCAGCATCAGAACTGTAGCATCTTTCTGTTCAGAGAAAAGAGTGGTGGCAATATACAACAAGAAATGTGAAGCTTTAAGAAAACAGGGAATTCGAAGCGGAATCGTTGGAGGGATTGGCTTAAGTTTCTCAAACTTGATGTTATATCTGACTTACGGTCTTTGCTTCTATGTTGGTGCAAAGTTCGTAAGTCAGGGAAAAACTACTTTTTCAGATGTTTTCAAAGTAAGAAATCCTAAAGTATTTCAAGTAACAATTGCCTATATGAATATTAATTCTAGTATCATTCACAAATGGGCTGGATGCTTTTCAGGTTTTCTTTGCTTTAGTTTTGGCAGCCGTTGGTGTTTCGCAGTCAAGTGCATTGTCTACTAATGCAACAAAGGCAAGGGATTCTGCCATTTCCATTTTTAGTATTATCGATCGGAAGTCTAGGATTGATTCAAGTAGCGACGAGGGAGCGATAATGGAAAACGTCACTGGCAGCATTGATTTCAATAATGTCAGTTTCAAGTACCCATCACGCCCTGATGTTCAAATATTCAGTGACTTTACCTTGCACATTCCTTCCCAAAAGGTATACTTCCACATTCACCTATTTGTCTTCCTTTTTCCTATTTCTTGAAACTAGTGCATGCCCAAAATTTCCATCAGAAAATTAACTTGATTATTGAACTATTTACATAATACAACTAGTAACATACTTCAAAATAGATGCGAGTGTGACCCATCCACTTCCGTGACATCATATGTGTTGATACACAACTTTACATTTTATTTTTTGCATCTCAGCATTTCCATGCACTGAAATAGTTATGACTAAACCTTTTCCTTCCTTTTCTACAGACCATAGCACTTGTTGGAGAAAGCGGTAGTGGGAAATCCACGATAATTGCTTTATTAGAGCGTTTCTATGATCCTGATTCTGGTAATATCTCACTAGATGGAGTTGAAATTAGAAGCTTAAAAGTCAGCTGGTTGAGGGATCAGATGGGGCTTGTAGGCCAGGAGCCAGTGCTTTTCAACGACACAATCCGTGCCAACATAACATACGGGAAACACAGTGAGGTAACAGAGGAAGAGATCACTGCTGTGGCCAAGGCAGCAAACGCCCATGAGTTCGTATCAAGCCTGCCACAAGGATACGACACAGTGGTAGGTGAGAAAGGGGTGCAACTATCTGGTGGGCAAAAACAGAGGGTAGCAATTGCAAGGGCCATCCTAAAGGACCCTAAGATACTGCTACTTGATGAGGCAACCAGTGCTCTAGATGCAGAATCAGAACGTGTTGTTCAAGATGCATTGGATCGAGTCATGGTCAACAGGACTACCATTGTAGTGGCACACCGCCTCTCCACAATCAAAGGGGCTGATATGATTGCAGTCCTCAAGGAAGGAAAAATTGCAGAAAAAGGAAAGCATGAAGCACTATTGCGGATCAAGGATGGTGCATATGCTTCACTTGTACAACTCCGCTCTAATTCCGAGTAA</dnaseqindica>|
 
Link = [http://plants.ensembl.org/Oryza_indica/Gene/Summary?g=BGIOSGA000971 EnsemblPlants:BGIOSGA000971]|
 
}}
 
[[Category:Genes]]
 
[[Category:Indica mRNA]]
 
[[Category:Oryza Sativa Indica Group]]
 
[[Category:Indica Genes]]
 
[[Category:Indica Chromosome 1]]
 
[[Category:Chromosome 1]]
 

Latest revision as of 05:10, 12 May 2015

Please input one-sentence summary here.

Annotated Information

Function

Multidrug and Toxic compound Extrusion proteins (MATE) are a family of secondary active transporters which utilize electrochemical gradient of membrane maintained by ATPases for their transport activity. Members of this transporter family have ubiquitous occurrence in all the organisms including human and plants. The first member of this family (NorM) was characterized from Vibriopara haemolyticus, which effluxes nofloxacin and ciprofloxacin outside of the cells in an energy dependent way. Most of the earlier studies suggest that MATE proteins act as an efflux pump that export majority of drugs and xenobiotic compounds outside the cell, and largely contribute to the drug resistance in bacteria. Recent reports indicate that MATE proteins function in antiport manner and drive the substrate transport in exchange with H+/Na+ depending on the organism. Studies suggest that H+ coupling is operational in plants, which is substituted by Na+ in bacteria. Though structure and mechanism of action of MATEs have not been studied in detail, recent investigations revealed conformation and transport behaviour of MATE proteins. Conversely to designated name “multidrug”, numerous studies revealed that MATE proteins have stringent substrate specificity and facilitate the movement of specific compounds. Presence of homologous putative MATEs has been identified from several organisms through comparative genomics. A genome wide scanning and analysis revealed that 58 MATE paralogues are present in Arabidopsis genome. In general, MATE proteins from various source organisms have a conserved domain and share at least 40% amino acid sequence homology. In higher plants, studies demonstrated that MATE proteins are mainly involved in the transport and trafficking of xenobiotic and small organic molecules. The foremost characterized Arabidopsis MATE protein, AtDTX1, was demonstrated to export norfloxacin due to its ability to restore drug tolerance in the norfloxacin sensitive bacterial mutant (kam3 mutant). Recently, evidences for role of MATEs in the plants are rapidly accumulating. Depending on the established functions of this gene family in plants, MATEs have been grouped into three major classes. The first group of the MATE has been demonstrated to be associated with disease resistance in Arabidopsis. Several Arabidopsis mutants have been identified and examined for understanding the molecular mechanism of pathogen resistance. Among them, enhanced disease susceptibility mutant (eds5) of Arabidopsis displayed a reduced basal resistance during pathogen interaction. The fine genetic mapping of the eds5 locus identified that EDS5, a member of the MATE transporter family, was localised within this locus, and substantially contributed to disease tolerance. The relation of EDS5 with disease tolerance has been explored very recently and demonstrated that EDS5 export salicylic acid (SA) outside chloroplast, where SA synthesis takes place. Similarly, ADS1 (activated disease susceptability1), a negative regulator for the disease resistance, was another MATE identified in Arabidopsis showing involvement during pathogen infection. A second group of MATE proteins is known for exporting small organic molecules such as citrate outside the cell which acts as a ligand molecule to bind aluminium (Al) in the rhizosphere. Unlike to other metals, Al toxicity is much pronounced in acidic soil and several genetic studies were performed to map the locus responsible for Al tolerance in plants. A locus for Al tolerance, AltSB, was identified that encode a MATE via positional cloning in sorghum. This SbMATE has been shown to efflux the citrate from cell and forming non-toxic complexes with Al in soil solution. Similar to sorghum, MATE proteins from Hordeum, Arabidopsis, Triticum and maize have been shown to participate in Al tolerance. Tandem duplication of MATE paralogues in the maize genome have been demonstrated to offer another level of transcriptional regulation to provide adaptation of maize to Al toxicity.

Expression

In order to investigate the function of OsMATE1 and OsMATE2, full-length cDNAs were expressed in Arabidopsis under control of a CaMV35S promoter. The presence and expression of transgene was confirmed through genomic and semiquantitative RTPCR. Depending upon relative expression and phenotypic appearance, three independent lines expressing OsMATE1 and OsMATE2 were selected for further study. Up to two weeks of germination in soil, growth pattern of the all transgenic lines was similar to WT plants. However, after two weeks of growth, transgenic lines expressing OsMATE1 or OsMATE2 displayed a distinguishable growth pattern in comparison to WT plants, but very similar to each other. The visible changes at the stage of three week old plants among all transgenic lines were quite prevalent that consist petiole length, leaf size and rosette leaf arrangement in vegetative parts. The pattern of rosette leaves of the mature plants was different in comparison to WT plants without any change in the number of leaves. Petiole length and rosette leaf size of the transgenic lines were significantly increased compared to the WT.Collectively, the expression of OsMATE1 and OsMATE2 resulted variation in vegetative tissues, including the leaf size and altered pattern of rosette development. To authenticate these inferences,growth of two T-DNA insertional mutants of Arabidopsis MATEs(SALK_045655C and SALK_124549C) having close sequence similarity with OsMATE1 and OsMATE2 were analysed. Interestingly, a cognate growth pattern of salk lines with WT plants was observed. Altogether, these observations suggest that OsMATE1 and OsMATE2 play important role in the growth and development of plants.

Evolution

You can also add sub-section(s) at will.Another, third group of MATE transporters are involved in trafficking of secondary metabolites in vacuoles. Usually, vacuoles are the major repository site of most of the conjugated form of flavonoids comprising mainly flavonols, anthocyanins and flavone glycoside. The transport and storage of these flavonoides into vacuole are mediated by the different class of transporters on tonoplast. A member of MATE gene family (TT12) was elucidated for sequestration of proanthocyanidins in vacuoles of seed that leads to pigmentation of seed coat. The kinetic study of vesicles isolated from TT12 expressing yeast revealed that it can specifically transport glycosidic form like epicatechin 3′-O-glucoside and cyanidin 3-O glucoside. Consistent to the TT12, MATEs from Medicago and Vitis have been characterized for mobilization of flavonoids in cell organelles. Similar to the role in vacuolar flavonoids sequestration, MATE proteins are also recognised for alkaloids trafficking into vacuoles in tobacco. Apart from these functions FRD3, a MATE citrate efflux transporter, was shown to involved in Fe transport towards stele region and hence assisted in distribution of Fe throughout aerial parts in Arabidopsis. Curiously, one member of MATE gene family (Mdt1) was shown to regulate the glucose assimilation, and which is thought to be necessary for nutrient utilization, sporulation and pathogenicity in fungi. In an another report, role of a MATE-like transporter (ZRZ) has been demonstrated in organ initiation as overexpression of this MATE led to diverse morphological changes in Arabidopsis. Therefore, it seems that MATEs govern the diverse physiological functions in the plants which need to be elucidated. Likewise to Arabidopsis, genome-wide analysis of MATEs encoding loci in rice revealed the presence of large members of this gene family however, function of only a few members has been elucidated as yet. Our earlier study suggested that expression of some of the genes encoding MATEs is up-regulated in rice seedlings exposed to arsenic (As) stress. Of these loci, we have investigated the role of two gene, OsMATE1 (Os03g08900) and OsMATE2 (Os05g48040) using heterologous system, Arabidopsis, in this study. Our observations suggest that these MATEs play crucial role in plant growth, development and in stress responses.

Labs working on this gene

National Botanical Research Institute, Council of Scientific and Industrial Research (CSIR), Rana Pratap Marg, Lucknow-226 001, INDIA.

Department of Botany, University of Lucknow, Lucknow-226007, INDIA.

The Scripps Research Institute,

References

1.Kuroda, T. & Tsuchiya, T. Multidrug efflux transporters in the MATE family.Biochim Biophys Acta 1794, 763–768 (2009).

2.Morita, Y. et al. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrob Agents Chemother 42, 1778–1782 (1998).

3.Morita, Y. et al. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrob Agents Chemother 42, 1778–1782 (1998).

4.Lu, M. et al. Structures of a Na1-coupled, substrate-bound MATE multidrug transporter. Proc Natl Acad Sci U S A 110, 2099–2104 (2013).

5.Zhao, J. & Dixon, R. A. MATE transporters facilitate vacuolar uptake of epicatechin 39-O-glucoside for proanthocyanidin biosynthesis in Medicago truncatula and Arabidopsis. Plant Cell 21, 2323–2340 (2009).

6.Hvorup, R. N. et al. The multidrug/oligosaccharidyl-lipid/polysaccharide (MOP) exporter superfamily. Eur J Biochem 270, 799–813 (2003).

Structured Information