Difference between revisions of "BGIOSGA029617"

From RiceWiki
Jump to: navigation, search
(→‎ZF-HD members in rice)
 
(10 intermediate revisions by one other user not shown)
Line 3: Line 3:
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
−
Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells
+
Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (LOC_Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells
  
 
===Expression===
 
===Expression===
 
qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. It was also speculated that it was involved in panicle development.
 
qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. It was also speculated that it was involved in panicle development.
 +
 +
[[File:mam123.jpg]]
  
 
== Brief introduction to ZF-HD transcription factor gene family ==
 
== Brief introduction to ZF-HD transcription factor gene family ==
Line 34: Line 36:
 
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University.
 
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University.
  
−
==References==
+
==Structured Information==
−
[1] Xu Y, Wang Y H, Long Q Z, et al. Overexpression of OsZHD1, a zinc finger homeodomain class homeobox transcription factor, induces abaxially curled and drooping leaf in rice[J]. Planta, 2014, 239: 803-816.
+
    [[Category:Genes]][[Category:Oryza Sativa Indica Group]][[Category:Indica Chromosome 9]]
−
[2] Windhovel A, Hein I, Dabrowa R, Stockhaus J. Characterization of a novel class of plant homeodomain proteins that bind to the C4 phosphoenolpyruvate carboxylase gene of Flaveria trinervia[J]. Plant molecular biology, 2001, 45(2): 201-214.
 
−
[3] Bürglin T R. A comprehensive classification of homeobox genes[M]. In: Duboule D (ed) Guidebook to the homeobox genes. pp. 25-71. Oxford: Oxford University Press.
 
−
[4] Mukherjee K, Brocchieri L, Burglin T R. A comprehensive classification and evolutionary analysis of plant homeobox genes[J]. Molecular biology and evolution, 2009, 26(12):2775-2794.
 
−
[5] Tran L S, Nakashima K, Sakuma Y, et al. Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis[J]. The plant journal, 2007, 49(1): 46-63.
 
−
[6] Park H C, Kim M L, Lee S M, et al. Pathogen-induced binding of the soybean zinc finger homeodomain proteins GmZF-HD1 and GmZF-HD2 to two repeats of ATTA homeodomain binding site in the calmodulin isoform 4 (GmCaM4) promoter[J]. Nucleic Acids Research, 2007, 35(11): 3612-3623.
 
  
 
==Structured Information==
 
==Structured Information==
 
{{IndicaGene|
 
{{IndicaGene|
−
GeneName = BGIOSGA029617|
+
GeneName = ''OsZHD1''|
−
Description = Putative uncharacterized protein|
+
Description =Zinc finger homeobox transcription factor|
 
Definition = Oryza sativa Indica Group BGIOSGA029617, complete gene.|
 
Definition = Oryza sativa Indica Group BGIOSGA029617, complete gene.|
 
tag = OJ1005_D12.28|
 
tag = OJ1005_D12.28|

Latest revision as of 09:13, 12 May 2015

Please input one-sentence summary here.

Annotated Information

Function

Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (LOC_Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells

Expression

qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. It was also speculated that it was involved in panicle development.

Mam123.jpg

Brief introduction to ZF-HD transcription factor gene family

In plant, the Zn finger homeodomain protein (ZF-HD) which is a class of homeobox TFs was first characterized in Flaveria trinervia (Asteraceae) by the presence of two highly conserved zinc finger-like motifs upstream of a HD[2]. To distinguish it from the unrelated zinc finger class of HD proteins, called ZF, found in animals[3], “PLINC” is proposed to be nominated as plant zinc finger[4]. Expression of PLINC genes is inducible by dehydration, salt stress and abscisic acid[5]. Microarray analysis of transgenic plants overexpressing PLINC gene revealed that several stress-inducible genes were upregulated, and these transgenic plants exhibited a strong drought-tolerant phenotype. Expression of two soybean PLINC proteins has been shown to be induced by pathogen stimulation[6]. These findings suggest that PLINC proteins play an important role against abiotic stress responses. PLINC genes are found in flowering plants, Selaginella and moss but not in unicellular green algae or in red algae[4], suggesting that this class originated within the Streptophyta clade and that it was already present in the last common ancestor of moss and vascular plants.


ZF-HD members in rice

Japonica Group

LOC_Os01g44430.1 LOC_Os02g47770.1 LOC_Os03g50920.1 LOC_Os04g35500.1 LOC_Os05g50310.1 LOC_Os06g23030.1 LOC_Os08g34010.1 LOC_Os08g37400.1 LOC_Os09g24810.1 LOC_Os09g24820.1 LOC_Os09g29130.1 LOC_Os11g03420.1 LOC_Os11g13930.1 LOC_Os12g03110.1 LOC_Os12g10630.1

Indica Group

BGIOSGA00115 BGIOSGA005769 BGIOSGA013464 BGIOSGA015067 BGIOSGA015069 BGIOSGA020427 BGIOSGA026798 BGIOSGA026924 BGIOSGA028731 BGIOSGA029617 BGIOSGA029765 BGIOSGA030752 BGIOSGA034224 BGIOSGA034718 BGIOSGA036923

Labs working on this gene

National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University.

Structured Information

Structured Information

Gene Name

OsZHD1

Description

Zinc finger homeobox transcription factor

Definition

Oryza sativa Indica Group BGIOSGA029617, complete gene.

LocusTag

OJ1005_D12.28

Ensembl Transcript ID

BGIOSGA029617-TA

Ensembl Protein ID

BGIOSGA029617-PA

Length

840

Source

Oryza sativa Indica Group 

 ORGANISM  Oryza sativa Indica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 9

Location

Chromosome 9:16349452..16350291

Sequence Coding Region

16349452..16350291

Genome Context

<gbrowseImage1> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</cdnaseq>

Protein Sequence

<aaseq>MDFDDHDDGDEEMPPMPVSSSYETPPQHGLAGGGMAPKPPGEIGSHVKGPSCGGGRYRECLKNHAVGIGGHAVDGCGEFMAAGEEGTIDALRCAACNCHRNFHRKESESLAGEGSPFSPAAVVPYGATPHHQFSPYYRTPAGYLHHHQHHMAAAAAAAAAAAGGHPQRPLALPSTSHSGRDDGDDLSGMVGPMSAVGPLSGMSLGAGPSGSGSGKKRFRTKFTQEQKDKMLAFAERVGWRIQKHDEAAVQQFCDEVGVKRHVLKVWMHNNKHTLGKKLP</aaseq>

Gene Sequence

<dnaseqindica>1..840#ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</dnaseqindica>

External Link(s)

EnsemblPlants:BGIOSGA029617

Retrieved from "https://ngdc.cncb.ac.cn/ricewiki/index.php?title=BGIOSGA029617&oldid=213834"