|
|
| Line 20: |
Line 20: |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]] |
| − | GeneName = Os01g0109000|
| |
| − | Description = Similar to Group 3 LEA (Type I) protein|
| |
| − | Version = NM_001185196.1 GI:297719526 GeneID:4326129|
| |
| − | Length = 1543 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os01g0109000, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
| |
| − | AP = Chromosome 1:494711..496253|
| |
| − | CDS = 495810..496028|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008394:494711..496253
| |
| − | source=RiceChromosome01
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008394:494711..496253
| |
| − | source=RiceChromosome01
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>cggcacatgcggcgaaggacaagacctccggcacggcgtaggcggcgagggacaaggccgccgagagcaaggaccagactagcggcttcctcggcgagaagaccgagaaggccaagcagaaggccaccgagaccgacgagacggcgcggtggagggttctgcatcggctccctgcacctgtcccaatttccatgccggctgccttttgttatattctaa</cdnaseq>|
| |
| − | AA = <aaseq>RHMRRRTRPPARRRRRGTRPPRARTRLAASSARRPRRPSRRPPR PTRRRGGGFCIGSLHLSQFPCRLPFVIF</aaseq>|
| |
| − | DNA = <dnaseqindica>226..444#acctctctcctcttcctttctctcaccgagcagggcaaccgacgggtgtggggaggagaccggtgggggaggcgggagacgggactccggcggtcggcgacgggcgacgaggcggcggcggcgacgacgcgggagcaggagggcctccccccacgccgccgccggcggaggaacgcagtgagctgccttaggtgggctctccggaggaagtcggcggcggtgtgacggcacatgcggcgaaggacaagacctccggcacggcgtaggcggcgagggacaaggccgccgagagcaaggaccagactagcggcttcctcggcgagaagaccgagaaggccaagcagaaggccaccgagaccgacgagacggcgcggtggagggttctgcatcggctccctgcacctgtcccaatttccatgccggctgccttttgttatattctaatcatcgtttttgtttatcaaatcaatttttgaacacaaccttttttactgaaggatgatgaaacaatgcacaagatcgtcttcagtaatcagtagttcagtggctggaagtttgcgtgcagcctgttgcgcttgcacccagtgaacgtgcacgagtaccgccgctccagctgctgcttgtccttaccaccgccgccggcggctttgtcagcatgggcacgctcttgtacttgtcactgtgtctacgcatgtgcatctgtaggttcgcgtcccgcttgagccacttgacgcagatggatcagaagcgcgtgtgctgcatcaggatttcatcctcctccgccggcgccgccaagcagaagaccaccgagacggcgtagtacaccaaggaatccgccgtcgctggcaaggacaagaccggtagcgtcctccaacaagtacacaccattagcaacctcggttaatttctccttgtcgaacaccattgttgtggattttgaggagaattcgtttgtgtttcaggcgagtgagcaggtgaagagcacggtggtcggcgccaaggacgcggtgatgaacacgctgggatgaccggagacaaggccgtcagcctatggtggcagcagcagtggctcacatcgacggcacacccaaggggatccgcggatggacgacggcggcaacgcgtcaccatcgtcctcgctctccagcgtcggcgcggcttgccctccagcgtcgcagcttccgccatcgccgcctcgtcgcccgctgcctcctcctctcccgcctcgccccgacgacctctccccacccgccgggcggcttgccgcttgcagttgcagagaaggagaaaagtgagagagagagagagaggagggatggagaggaaatggaagagagagggtgctgacgtggcatcctgacatgtgggttccacgctgagtcagccgtcacgtcggacaaaaccgtagtcaaaaccaccgatggatctaatttgcactggttttgtaagttggaggatgcgttgtatccagttttgtggttggaggacgattttgtaattcgatgacaagttaagggatcttcggggtactttttccttttgc</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001185196.1 RefSeq:Os01g0109000]|
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Chromosome 1]] | |
| − | [[Category:Chromosome 1]]
| |
Latest revision as of 04:29, 14 May 2015
Please input one-sentence summary here.
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
