|
|
| (52 intermediate revisions by one other user not shown) |
| Line 3: |
Line 3: |
| | ==Annotated Information== | | ==Annotated Information== |
| | ===Function=== | | ===Function=== |
| − | Please input function information here.
| + | PLDα occupies a critical step in controlling stomatal movements and plant response to water stress.<ref name = "ref1"/> PLDα is the common plant PLD that does not require phosphatidylinositol 4, 5-bisphosphate (PIP2) for activity, when assayed at millimolar concentrations of Ca2+.<ref name="ref2"/> PLDα1 promotes abscisic acid (ABA)-induced stomatal closure and regulates ABA-inhibited stomatal opening.<ref name = "ref1"/><ref name = "ref3"/><ref name = "ref4"/> OsPLDα1 regulates salt tolerance in rice by activating H+-ATPase activity and transcription in tonoplast and plasma membrane. We also found that OsPLDα1 is important to transiently activate ''OsCDPK7'' transcription in response to NaCl stress.<ref name="ref5"/> There are many PLDs in rice even OsPLDα can be consist of OsPLDα(1, 2, 3, 4, 5, 6, 7, 8 ), different genes own the same function or the partial overlapped function. Venn diagram for differentially expressed PLDs. PLD genes up- and down-regulated (A) under different abiotic stress conditions, (B) under stresses and developmental stages. Different compartments showing genes specific to either a particular stress/developmental stage or more than one stress and/or developmental stage.<ref name="ref6"/> |
| − | PLDα occupies a critical step in controlling stomatal movements and plant response to water stress.<ref name = “ref1”/> | + | |
| − | PLDα is the common plant PLD that does not require phosphatidylinositol 4, 5-bisphosphate (PIP2) for activity, when assayed at millimolar concentrations of Ca2+.<ref name=”ref2”/> | + | [[File:FFig2.jpg]] |
| − | PLDα1 promotes abscisic acid (ABA)-induced stomatal closure and regulates ABA-inhibited stomatal opening.<ref name = “ref3”/>. | |
| − | OsPLDα1 regulates salt tolerance in rice by activating H+-ATPase activity and transcription in tonoplast and plasma membrane. We also found that OsPLDα1 is important to transiently activate OsCDPK7 transcription in response to NaCl stress.<ref name=”ref4”/> | |
| | | | |
| | ===Expression=== | | ===Expression=== |
| Line 13: |
Line 11: |
| | | | |
| | ===Evolution=== | | ===Evolution=== |
| − | Please input evolution information here.
| + | Expression of rice PLD gene family has been represented by a heat map. Developmental stages comprising three vegetative stages (L-leaf, R-root and SL-7d-old seeding), six stages of panicle [P1 (0-3 cm), P2 (3-5 cm), P3 (5-10 cm), P4 (10-15 cm), P5 (15-22 cm) and P6 (22-30 cm)] and five stages of seed [S1(0-2 DAP), S2(3-4 DAP), S3(4-10 DAP), S4(11-20 DAP) and S5(21-29 DAP)]. Clustering of the expression profile was done with log transformed average values taking mature leaf as base line. Three stress conditions are denoted as C, Cold stress; D, Drought stress; S, Salt stress and SL, control, seven day old unstressed seedling.<ref name="ref6"/> |
| | | | |
| − | You can also add sub-section(s) at will.
| + | [[File:FFig1.jpg]] |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| − | Please input related labs here.
| + | State Key Laboratory of Crop genetics and Germplasm Enhancement; Eastern Cereal and Oilseeds Research Center;Department of Plant Molecular Biology. |
| | | | |
| | ==References== | | ==References== |
| − | Please input cited references here.
| + | <references> |
| − | <ref name=“ref1”>Sang Y, Zhang S, Li W, Huang B, Wang X (2001), Regulation of plant water loss by manipulating the expression of phospholipase Dα. ''Plant J.'' 28, 135-144.</ref> | + | <ref name="ref1">Sang Y, Zhang S, Li W, Huang B, Wang X (2001), Regulation of plant water loss by manipulating the expression of phospholipase Dα. Plant J. 28:135-144. </ref> |
| − | <ref name=”ref2”>Pappan, K. Zheng, S. Wang, X (1997) Identification and characterization of a novel phospholipase D that requires polyphosphoinositides and submicromolar calcium for activity in Arabidopsis. ''J. Biol. Chem.'' 272, 7048± 7054.</ref> | + | <ref name="ref2">Pappan, K. Zheng, S. Wang, X (1997) Identification and characterization of a novel phospholipase D that requires polyphosphoinositides and submicromolar calcium for activity in Arabidopsis. J. Biol. Chem. 272:7048±7054. </ref> |
| − | <ref name=”ref3”>Mishra G, Zhang W, Deng F, Wang X (2006) A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. ''Science'' 312, 264-266.</ref> | + | <ref name="ref3">Zhang W, Qin C, Zhao J, Wang X (2004) Phospholipase Dα1-derived phosphatidic acid interacts with ABI1 phosphatase 2C and regulates abscisic acid signaling. Proc. Natl. Acad. Sci. USA. 101:9508 - 9513. </ref> |
| − | <ref name=”ref4”>Shen P, Wang R, Jing W, Zhang W (2011) Rice phospholipase Dα is involved in salt tolerance by the mediation of H+-ATPase activity and transcription. ''J. Integr. Plant Biol.'' 53(4), 289 - 299.</ref> | + | <ref name="ref4">Mishra G, Zhang W, Deng F, Wang X (2006) A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science 312:264-266. </ref> |
| − | | + | <ref name="ref5">Shen P, Wang R, Jing W, Zhang W (2011) Rice phospholipase Dα is involved in salt tolerance by the mediation of H+-ATPase activity and transcription. J. Integr. Plant Biol. 53(4):289 - 299. </ref> |
| | + | <ref name="ref6">Singh A, Pandey A, Pandey G et al (2012) Comprehensive expression analysis of rice phospholipase D gene family during abiotic stresses and development. Plant Signaling Behavior. 7(7):847-855. </ref> |
| | + | </references> |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]] |
| − | GeneName = Os01g0172400|
| |
| − | Description = Phospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1)|
| |
| − | Version = NM_001048688.1 GI:115434789 GeneID:4327647|
| |
| − | Length = 4181 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os01g0172400, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
| |
| − | AP = Chromosome 1:3723613..3727793|
| |
| − | CDS = 3723983..3724416,3724895..3726791,3727332..3727439|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008394:3723613..3727793
| |
| − | source=RiceChromosome01
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008394:3723613..3727793
| |
| − | source=RiceChromosome01
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atggcgcagatgctgctccatgggacgctgcacgccaccatcttcgaggcggcgtcgctctccaacccgcaccgcgccagcggaagcgcccccaagttcatccgcaagtttgtggaggggattgaggacactgtgggtgtcggcaaaggcgccaccaaggtgtattctaccattgatctggagaaagctcgtgtagggcgaactaggatgataaccaatgagcccatcaaccctcgctggtatgagtcgttccacatctattgcgctcatatggcttccaatgtgatcttcactgtcaagattgataaccctattggggcaacgaatattgggagggcttacctgcctgtccaagagcttctcaatggagaggagattgacagatggctcgatatctgtgataataaccgcgagcctgttggtgagagcaagatccatgtgaagcttcagtacttcgatgtttccaaggatcgcaattgggcgaggggtgtccgcagtaccaagtatccaggtgttccttacaccttcttctctcagaggcaagggtgcaaagttaccttgtaccaagatgctcatgtcccagacaacttcattccaaagattccgcttgccgatggcaagaattatgaaccccacagatgctgggaggatatctttgatgctataagcaatgctcaacatttgatttacatcactggctggtctgtatacactgagatcaccttggttagggactccaatcgtccaaaacctggaggggatgtcacccttggggagttgctcaagaagaaggccagtgaaggtgttcgggtcctcatgcttgtgtgggatgacaggacttcagttggtttgctaaagagggatggcttgatggcaacacatgatgaggaaactgaaaattacttccatggctctgacgtgaactgtgttctatgccctcgcaaccctgatgactcaggcagcattgttcaggatctgtcgatctcaactatgtttacacaccatcagaagatagtagttgttgaccatgagttgccaaaccagggctcccaacaaaggaggatagtcagtttcgttggtggccttgatctctgtgatggaaggtatgacactcagtaccattctttgtttaggacactcgacagtacccatcatgatgacttccaccagccaaactttgccactgcatcaatcaaaaagggtggacctagagagccatggcatgatattcactcacggctggaagggccaatcgcatgggatgttctttacaatttcgagcagagatggagaaagcagggtggtaaggatctccttctgcagctcagggatctgtctgacactattattccaccttctcctgttatgtttccagaggacagagaaacatggaatgttcagctatttagatccattgatggtggtgctgcttttgggttccctgatacccctgaggaggctgcaaaagctgggcttgtaagcggaaaggatcaaatcattgacaggagcatccaggatgcatacatacatgccatccggagggcaaagaacttcatctatatagagaaccaatacttccttggaagttcctatgcctggaaacccgagggcatcaagcctgaagacattggtgccctgcatttgattcctaaggagcttgcactgaaagttgtcagtaagattgaagccggggaacggttcactgtttatgttgtggtgccaatgtggcctgagggtgttccagagagtggatctgttcaggcaatcctggactggcaaaggagaacaatggagatgatgtacactgacattacagaggctctccaagccaagggaattgaagcgaaccccaaggactacctcactttcttctgcttgggtaaccgtgaggtgaagcaggctggggaatatcagcctgaagaacaaccagaagctgacactgattacagccgagctcaggaagctaggaggttcatgatctatgtccacaccaaaatgatgatagttgacgatgagtacatcatcatcggttctgcaaacatcaaccagaggtcgatggacggcgctagggactctgagatcgccatgggcgggtaccagccataccatctggcgaccaggcaaccagcccgtggccagatccatggcttccggatggcgctgtggtacgagcacctgggaatgctggatgatgtgttccagcgccccgagagcctggagtgtgtgcagaaggtgaacaggatcgcggagaagtactgggacatgtactccagcgacgacctccagcaggacctccctggccacctcctcagctaccccattggcgtcgccagcgatggtgtggtgactgagctgcccgggatggagtactttcctgacacacgggcccgcgtcctcggcgccaagtcggattacatgccccccatcctcacctcatag</cdnaseq>|
| |
| − | AA = <aaseq>MAQMLLHGTLHATIFEAASLSNPHRASGSAPKFIRKFVEGIEDT VGVGKGATKVYSTIDLEKARVGRTRMITNEPINPRWYESFHIYCAHMASNVIFTVKID NPIGATNIGRAYLPVQELLNGEEIDRWLDICDNNREPVGESKIHVKLQYFDVSKDRNW ARGVRSTKYPGVPYTFFSQRQGCKVTLYQDAHVPDNFIPKIPLADGKNYEPHRCWEDI FDAISNAQHLIYITGWSVYTEITLVRDSNRPKPGGDVTLGELLKKKASEGVRVLMLVW DDRTSVGLLKRDGLMATHDEETENYFHGSDVNCVLCPRNPDDSGSIVQDLSISTMFTH HQKIVVVDHELPNQGSQQRRIVSFVGGLDLCDGRYDTQYHSLFRTLDSTHHDDFHQPN FATASIKKGGPREPWHDIHSRLEGPIAWDVLYNFEQRWRKQGGKDLLLQLRDLSDTII PPSPVMFPEDRETWNVQLFRSIDGGAAFGFPDTPEEAAKAGLVSGKDQIIDRSIQDAY IHAIRRAKNFIYIENQYFLGSSYAWKPEGIKPEDIGALHLIPKELALKVVSKIEAGER FTVYVVVPMWPEGVPESGSVQAILDWQRRTMEMMYTDITEALQAKGIEANPKDYLTFF CLGNREVKQAGEYQPEEQPEADTDYSRAQEARRFMIYVHTKMMIVDDEYIIIGSANIN QRSMDGARDSEIAMGGYQPYHLATRQPARGQIHGFRMALWYEHLGMLDDVFQRPESLE CVQKVNRIAEKYWDMYSSDDLQQDLPGHLLSYPIGVASDGVVTELPGMEYFPDTRARV LGAKSDYMPPILTS</aaseq>|
| |
| − | DNA = <dnaseqindica>3378..3811#1003..2899#355..462#agtctctcttctcccgcaattttataatctcgctcgatccaatctgctccccttcttcttctactctccccatctcggctctcgccatcgccatcctcctctcccttcccggagaagacgcctccctccgccgatcaccacccggtaagcccagtgtgcttaggctaagcgcactagagcttcttgctcgcttgcttcttctccgctcagatctgcttgcttgcttgcttcgctagaaccctactctgtgctgcgagtgtcgctgcttcgtcttccttcctcaagttcgatctgattgtgtgtgtgggggggcgcaggtagggcgaggagggagccaaatccaaatcagcagccatggcgcagatgctgctccatgggacgctgcacgccaccatcttcgaggcggcgtcgctctccaacccgcaccgcgccagcggaagcgcccccaagttcatccgcaaggttcggacccttctccttaatctactcgtctttgctcttgctctttttcttttttgtccctttcttgtgtgtgcgtttgcatgagcccgaatttgatctgctagtgcacagtacagtcagatacactgaaacgatctggaaattctggattattaggaaaaataaagaggtagtagacaagaattggagatactttctatcaagattggtctattatgcttggccatttcttgtttgacccaagtacttctttgaatctagagtttgctgtgtgtgatgtggtgtgtgtttgtgtcaccaaaaatcttcattagctaaaactgaaattttatttattaactgacctactaaaaatgtagagttctctgtgtgtgatgtgtgcttgtgtcaccaaaaatcttgatttgatagagtttttatttatttattaactgacctactacaaatctattgctgtatgctatgtgtgtctgtatcacctgaaatgcaatgtcttcttctttgttgttcttgatctaacacgtgagctcatgtcaacagtttgtggaggggattgaggacactgtgggtgtcggcaaaggcgccaccaaggtgtattctaccattgatctggagaaagctcgtgtagggcgaactaggatgataaccaatgagcccatcaaccctcgctggtatgagtcgttccacatctattgcgctcatatggcttccaatgtgatcttcactgtcaagattgataaccctattggggcaacgaatattgggagggcttacctgcctgtccaagagcttctcaatggagaggagattgacagatggctcgatatctgtgataataaccgcgagcctgttggtgagagcaagatccatgtgaagcttcagtacttcgatgtttccaaggatcgcaattgggcgaggggtgtccgcagtaccaagtatccaggtgttccttacaccttcttctctcagaggcaagggtgcaaagttaccttgtaccaagatgctcatgtcccagacaacttcattccaaagattccgcttgccgatggcaagaattatgaaccccacagatgctgggaggatatctttgatgctataagcaatgctcaacatttgatttacatcactggctggtctgtatacactgagatcaccttggttagggactccaatcgtccaaaacctggaggggatgtcacccttggggagttgctcaagaagaaggccagtgaaggtgttcgggtcctcatgcttgtgtgggatgacaggacttcagttggtttgctaaagagggatggcttgatggcaacacatgatgaggaaactgaaaattacttccatggctctgacgtgaactgtgttctatgccctcgcaaccctgatgactcaggcagcattgttcaggatctgtcgatctcaactatgtttacacaccatcagaagatagtagttgttgaccatgagttgccaaaccagggctcccaacaaaggaggatagtcagtttcgttggtggccttgatctctgtgatggaaggtatgacactcagtaccattctttgtttaggacactcgacagtacccatcatgatgacttccaccagccaaactttgccactgcatcaatcaaaaagggtggacctagagagccatggcatgatattcactcacggctggaagggccaatcgcatgggatgttctttacaatttcgagcagagatggagaaagcagggtggtaaggatctccttctgcagctcagggatctgtctgacactattattccaccttctcctgttatgtttccagaggacagagaaacatggaatgttcagctatttagatccattgatggtggtgctgcttttgggttccctgatacccctgaggaggctgcaaaagctgggcttgtaagcggaaaggatcaaatcattgacaggagcatccaggatgcatacatacatgccatccggagggcaaagaacttcatctatatagagaaccaatacttccttggaagttcctatgcctggaaacccgagggcatcaagcctgaagacattggtgccctgcatttgattcctaaggagcttgcactgaaagttgtcagtaagattgaagccggggaacggttcactgtttatgttgtggtgccaatgtggcctgagggtgttccagagagtggatctgttcaggcaatcctggactggcaaaggagaacaatggagatgatgtacactgacattacagaggctctccaagccaagggaattgaagcgaaccccaaggactacctcactttcttctgcttgggtaaccgtgaggtgaagcaggctggggaatatcagcctgaagaacaaccagaagctgacactgattacagccgagctcaggaagctaggaggttcatgatctatgtccacaccaaaatgatgataggtaccgagtgagctttatattacatatttgcattcactatgcaatttttgttcatttaaagcatgtcagatgagttacatacttatgtagcatttgttaattttttttaccaagtattgcatttgtctatttattagtttatatgcattgcatatgtcaagctctaagttgaagtcatgcttccctttactcttaaagtaacatctttttagacagaattgtcttctgctctctaaatctgtttctgtttaatacaggtttttatttttaaagaaataatgtcgtattgtaggttatttagctgattttactgttgcattctgtcgttctaaaaagatgaaaatccttttaacaaaagaaataaacaagatcctctaatgatcaagctagtaacttcatctccttattcggtttcttttttctatcaaaaatatacacttattgttcaagctagtaacttcatttcttccattttcagttgacgatgagtacatcatcatcggttctgcaaacatcaaccagaggtcgatggacggcgctagggactctgagatcgccatgggcgggtaccagccataccatctggcgaccaggcaaccagcccgtggccagatccatggcttccggatggcgctgtggtacgagcacctgggaatgctggatgatgtgttccagcgccccgagagcctggagtgtgtgcagaaggtgaacaggatcgcggagaagtactgggacatgtactccagcgacgacctccagcaggacctccctggccacctcctcagctaccccattggcgtcgccagcgatggtgtggtgactgagctgcccgggatggagtactttcctgacacacgggcccgcgtcctcggcgccaagtcggattacatgccccccatcctcacctcatagacgaggaagcactacactacaatctgctggcttctcctgtcagtccttctgtacttcttcagtttggtggcgagatggtatggccgttgttcagaatttcttcagaatagcagttgttacagttgtgaatcataaagtaataagtgcagtatctgtgcatggttgagttgggaagaagatcggggatgcaatgatgcttgtgaagttgtgatgccgtttgtaagatgggaagttgggaactactaagtaattggcatgattgtactttgcactactgtttagcgttgttgatactggttaaccgtgtgttcatctgaacttgattcttgatgcagtttgtggcattaccagtttatcatcgttcttcagg</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001048688.1 RefSeq:Os01g0172400]|
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]] | |
| − | [[Category:Japonica Chromosome 1]]
| |
| − | [[Category:Chromosome 1]]
| |
Please input one-sentence summary here.
Annotated Information
Function
PLDα occupies a critical step in controlling stomatal movements and plant response to water stress.[1] PLDα is the common plant PLD that does not require phosphatidylinositol 4, 5-bisphosphate (PIP2) for activity, when assayed at millimolar concentrations of Ca2+.[2] PLDα1 promotes abscisic acid (ABA)-induced stomatal closure and regulates ABA-inhibited stomatal opening.[1][3][4] OsPLDα1 regulates salt tolerance in rice by activating H+-ATPase activity and transcription in tonoplast and plasma membrane. We also found that OsPLDα1 is important to transiently activate OsCDPK7 transcription in response to NaCl stress.[5] There are many PLDs in rice even OsPLDα can be consist of OsPLDα(1, 2, 3, 4, 5, 6, 7, 8 ), different genes own the same function or the partial overlapped function. Venn diagram for differentially expressed PLDs. PLD genes up- and down-regulated (A) under different abiotic stress conditions, (B) under stresses and developmental stages. Different compartments showing genes specific to either a particular stress/developmental stage or more than one stress and/or developmental stage.[6]
Expression
Please input expression information here.
Evolution
Expression of rice PLD gene family has been represented by a heat map. Developmental stages comprising three vegetative stages (L-leaf, R-root and SL-7d-old seeding), six stages of panicle [P1 (0-3 cm), P2 (3-5 cm), P3 (5-10 cm), P4 (10-15 cm), P5 (15-22 cm) and P6 (22-30 cm)] and five stages of seed [S1(0-2 DAP), S2(3-4 DAP), S3(4-10 DAP), S4(11-20 DAP) and S5(21-29 DAP)]. Clustering of the expression profile was done with log transformed average values taking mature leaf as base line. Three stress conditions are denoted as C, Cold stress; D, Drought stress; S, Salt stress and SL, control, seven day old unstressed seedling.[6]
Labs working on this gene
State Key Laboratory of Crop genetics and Germplasm Enhancement; Eastern Cereal and Oilseeds Research Center;Department of Plant Molecular Biology.
References
- ↑ 1.0 1.1 Sang Y, Zhang S, Li W, Huang B, Wang X (2001), Regulation of plant water loss by manipulating the expression of phospholipase Dα. Plant J. 28:135-144.
- ↑ Pappan, K. Zheng, S. Wang, X (1997) Identification and characterization of a novel phospholipase D that requires polyphosphoinositides and submicromolar calcium for activity in Arabidopsis. J. Biol. Chem. 272:7048±7054.
- ↑ Zhang W, Qin C, Zhao J, Wang X (2004) Phospholipase Dα1-derived phosphatidic acid interacts with ABI1 phosphatase 2C and regulates abscisic acid signaling. Proc. Natl. Acad. Sci. USA. 101:9508 - 9513.
- ↑ Mishra G, Zhang W, Deng F, Wang X (2006) A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science 312:264-266.
- ↑ Shen P, Wang R, Jing W, Zhang W (2011) Rice phospholipase Dα is involved in salt tolerance by the mediation of H+-ATPase activity and transcription. J. Integr. Plant Biol. 53(4):289 - 299.
- ↑ 6.0 6.1 Singh A, Pandey A, Pandey G et al (2012) Comprehensive expression analysis of rice phospholipase D gene family during abiotic stresses and development. Plant Signaling Behavior. 7(7):847-855.
Structured Information