Difference between revisions of "Os02g0799100"

From RiceWiki
Jump to: navigation, search
(Expression(Mutant VS Wild type))
(Structured Information)
 
(73 intermediate revisions by 2 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The ''Ossgo1''gene encodes the protein OsSGO1 which  maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis.
  
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments[1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1[2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition (Che et al., 2011).OsSGO1 is specifically required to protect centromeric cohesion during meiosis.OsSGO1 transfers from nucleoli onto centromeres at the onset of prophase in both meiosis and mitosis.The relocalization of OsSGO1 onto centromeres is OsAM1-dependent.The maintenance of SCs in prophase I is affected inOssgo1.
+
Os02g0799100 is the rice(''Oryza sativa'') homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (''Zea mays''), named OsSGO1. The gene ''OsSGO1'' is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of ''OsSGO1'' may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the ''OsSGO1'' localizes to centromere from the result of immunostaining experiments <ref name="ref1" />. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1 <ref name="ref2" />. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition <ref name="ref3" />. Overall, OsSGO1 is specifically required to protect centromeric cohesion during meiosis. And OsSGO1 transfers from nucleoli onto centromeres at the onset of prophase in both meiosis and mitosis.Concurrently,The relocalization of OsSGO1 onto centromeres is OsAM1-dependent.The maintenance of SCs in prophase I is affected in ''Ossgo1'' <ref name="ref2" />.
  
 
===Mutation===
 
===Mutation===
An OsSGO1-RNAi vector is transformed into rice calli by Agrobacterium-mediated DNA transfer. OsSGO1-RNAi lines isobtained by screening the plants regenerated from the transformed calli by PCR[1]. One single Tos17-insertion mutant line of the OsSGO1 gene, Ossgo1-1, was identified by screening the public insertion line collections. Sequence analysis of its PCR products confirmed that Tos17 was inserted into exon 15, only 5 bp upstream from the stop codon (Figure S1) [2].
+
[[File:Figure S1.jpg|right|thumb|300px|''Schematic representation of OsSGO1 gene (from reference <ref name="ref2" />).'']]
 +
An OsSGO1-RNAi vector is transformed into rice calli by Agrobacterium-mediated DNA transfer. OsSGO1-RNAi lines is obtained by screening the plants regenerated from the transformed calli by PCR. One single ''Tos17''-insertion mutant line of the ''OsSGO1'' gene, named ''Ossgo1-1'', is identified by screening the public insertion line collections. Sequence analysis of its PCR products confirm that ''Tos17'' is inserted into exon 15, only 5 bp upstream from the stop codon(Figure S1). <ref name="ref2" /> .
  
===Expression(Mutant VS Wild type)===
+
===Expression(Mutant VS. Wild type)===
OsSGO1 is expressed most highly in the roots, secondly in the panicles, and at a relatively low level in leaves (Figure S3) [2].  
+
[[File:FigureS2.jpg|right|thumb|300px|''Expression analysis of OsSGO1 (from reference <ref name="ref2" />).'']]
The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophase Ⅰand anaphase II, respectively, which finally leads to sterile pollen formation[1]. The homozygous Ossgo1-1 mutant grew normally in the vegetative stage but was sterile during the flowering phase, and its pollen was completely non-viable when evaluated by 1% I2-KI solution staining (Figure S4). The transcription level of OsSGO1 was slightly decreased in the Ossgo1-1 mutant (Figure S3). Additionally, by performing RT-PCR, we found that the Ossgo1-1 cDNA sequence is altered downstream of the Tos17-insertion position by the addition of 71 nucleotides, and the whole cDNA lacks a stop codon (Figure S5). Additionally, we identified an allelic mutant of Ossgo1-1 with a deletion of 15 bp (nucleotides 1773–1787 in the gene) from the mutants induced by 60Co�c-ray radiation and named as Ossgo1-2 (Figure S1), which results in five amino acids missing in OsSGO1. The homozygous Ossgo1-2 mutant was also normal in the vegetative stage but completely sterile (Figure S4). Neither of the mutants set seeds when pollinated with pollen from the wild-type plants [2].
+
[[File:FigureS3.jpg|right|thumb|300px|''Characterization of the phenotype of ''Ossgo1'' mutants (from reference <ref name="ref2" />).'']]
 +
[[File:FigureS4.jpg|right|thumb|300px|''The defective cDNA sequence from ''Ossgo1-1'' mutant (from reference <ref name="ref2" />).'']]
 +
[[File:FigureS5.jpg|right|thumb|300px|''Western blotting analysis of OsSGO1 expression (from reference <ref name="ref2" />).'']]
 +
 
 +
''OsSGO1'' is expressed most highly in the roots, secondly in the panicles, and at a relatively low level in leaves(Figure S3)<ref name="ref2" />.  
 +
The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophase Ⅰand anaphase II, respectively, which finally leads to sterile pollen formation<ref name="ref1" />. The homozygous ''Ossgo1-1'' mutant grows normally in the vegetative stage but is sterile during the phase of flowering, and its pollen is completely non-viable when evaluated by 1% I2-KI solution staining (Figure S4). The transcription level of OsSGO1 is slightly decreased in the ''Ossgo1-1'' mutant (Figure S3). Additionally, by performing RT-PCR, it is found that the ''Ossgo1-1'' cDNA sequence is altered downstream of the ''Tos17''-insertion position by adding 71 nucleotides, and the whole cDNA lacks a stop codon (Figure S5). Furthermore, an allelic mutant of ''Ossgo1-1'' with a deletion of 15 bp (nucleotides 1773–1787 in the gene) from the mutants induced by 60 Co~γ-ray radiation is identified and is named as ''Ossgo1-2'' (Figure S1), resulting in five amino acids missing in OsSGO1. The homozygous ''Ossgo1-2'' mutant is also normal in the vegetative stage but completely sterile (Figure S4). Neither of the mutants set seeds when pollinated with pollen from the wild-type plants. In addition, it is found that the expression level of OsSGO1 protein is indeed down-regulated in Ossgo1-1 and OsSGO1RNAi plants through immunoblotting (Figure S5) <ref name="ref2" />.
  
 
{| class='wikitable' style="text-align:center"
 
{| class='wikitable' style="text-align:center"
Line 20: Line 26:
 
| rowspan="3"|Gene amplication
 
| rowspan="3"|Gene amplication
 
| | 5'-CGAAACCTCATCGGATTCCT-3'
 
| | 5'-CGAAACCTCATCGGATTCCT-3'
| | 5'-GCCAATGGTGTTTGTGCTCT-3' (used to amplify the predicted coding regions of OsSGO1 <ref name="ref2" />)
+
| | 5'-GCCAATGGTGTTTGTGCTCT-3' (used to amplify the predicted coding regions of ''OsSGO1'' <ref name="ref2" />)
 
|-
 
|-
 
| | 5'-ATTGTTAGGTTGCAAGTTAGTTAAGA'
 
| | 5'-ATTGTTAGGTTGCAAGTTAGTTAAGA'
| | 5'-GCCTCGAACAAAGAGGACTG-3' (used to amplify the Tos17 inserted regions of ossgo1 <ref name="ref2" />)
+
| | 5'-GCCTCGAACAAAGAGGACTG-3' (used to amplify the ''Tos17'' inserted regions of ''ossgo1'' <ref name="ref2" />)
 
|-
 
|-
 
| | 5'-GTGAATTCCCATTGAGGATCCAGAGCCACCA-3'
 
| | 5'-GTGAATTCCCATTGAGGATCCAGAGCCACCA-3'
| | 5'-AGTCTCGAGTACCTATCACCTGCTCGTCAGA-3' (used to amplify the fragment of OsSGO1 cDNA <ref name="ref2" />)
+
| | 5'-AGTCTCGAGTACCTATCACCTGCTCGTCAGA-3' (used to amplify the fragment of ''OsSGO1'' cDNA <ref name="ref2" />)
 
|-
 
|-
 
| rowspan="2"|RT-PCR
 
| rowspan="2"|RT-PCR
Line 34: Line 40:
  
 
===Evolution===
 
===Evolution===
Please input evolution information here.
+
[[File:Figure S2.jpg|right|thumb|300px|''Alignment of OsSGO1 with ZmSGO1 in maize (from reference <ref name="ref2" />).'']]
 +
''SGO1'' gene is the first meiosis specificity expressed gene in yeast cDNA library screening conducted in Watanabe Lab, as well as to the lack of corresponding mutant phenotype analysis, identified as the homologous gene of Drosophila melanogaster Mei - S332 <ref name="ref4" /><ref name="ref5" />. Many researches of SGO function have been investigated in animals and yeast <ref name="ref6" />, while relatively few has been reported in plants. In plants, ''SGO1'' gene is first found in maize, and the mutant of premature-dissociation centromeric cohesion which locates in the centromere at the stage of anaphase Ⅰ. And the phenotype is due to the deletion of ZmSGO1 protein. ZmSGO1 is found to be located in the centromere from the eptotene stage Previous studies indicates that ZmSGO1 plays an important role in protecting of centromeric cohesion during meiosis I <ref name="ref7" />. The OsSGO1 protein sequence,which comprises 486 amino acid residues, shows a high similarity toZmSGO1(209/537 residues identical and 278/537 residues positive(Figure S2)<ref name="ref2" />.
 +
 
 
===Knowledge Extension===
 
===Knowledge Extension===
Please input evolution information here.
+
 
You can also add sub-section(s) at will.
+
OsSGO1 is a shugoshin protein. Shugoshin is a conserved protein in eukaryotes that protects the centromeric cohesin of sister chromatids from cleavage by separase during meiosis<ref name="ref2" />. Shugoshins (Japanese for ‘guardian spirit’) are the conserved proteins required to protect the cohesin adjacent to the centromeres from cleavage by separase. ''Drosophila'' Mei-S332 is the first protein in the shugoshin family to be discovered, which  is necessary for chromosome precise separation <ref name="ref4" /><ref name="ref8" /><ref name="ref9" />. From then, shugoshins have been identified in various organisms from yeast to humans. ''Saccharomyces cerevisiae'' and ''Drosophila'' have only one kinds of shugoshin, which is expressed in both mitosis and meiosis, while ''Schizosaccharomyces pombe'' and mammals have two (Sgo1 and Sgo2) <ref name="ref4" /><ref name="ref10" />. There are two conserved domains in shugoshin proteins: one  is the basic region in the C-terminal, which is required for chromosomal localization; the other is the coiled-coil that is located near the N-terminal, which may mediate homodimerization and interactions with other proteins<ref name="ref4" /><ref name="ref11" />. The activity of shugoshin is controlled by an accurate and complicated process during cell divisions. In ''S. pombe'', the location of Sgo1 is regulated by the kinase, Bub1, and its degradation at anaphase I is controlled by the anaphasepromoting complex (APC)<ref name="ref4" />.SGO1 is loaded onto  the chromosome during leptotene, which is much earlier than that in other organisms,in plants such as rice and maize, and it disassociates during anaphase I. ZmSGO1 is reported to localize at both the centromere core and the pericentromeric regions<ref name="ref7" />.
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
 
 +
*State Key Laboratory of Plant Genomics and Center for Plant Gene Research, Institute of Genetics and Developmental Biology,Chinese Academy of Sciences, Beijing 100101, China
 +
*Yangzhou University, Yangzhou 225009, Jiangsu Province; Institute of Genetics,Chinese Academy of Sciences, Beijing 100101
  
 
==References==
 
==References==
Please input cited references here.
+
<references>
 +
<ref name="ref1"> ChiZhengchang. (2010) Functional Analysis of the Meiotic Gene ''OsSGO1'' in ''Oryza sativa''. Yangzhou university </ref>
 +
<ref name="ref2"> Mo Wang, Ding Tang, Kejian Wang, et.al. (2011) OsSGO1 maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis. The Plant Journal. 67 : 583-594 </ref>
 +
<ref name="ref3">Che, L., Tang, D., Wang, K., et.al. (2011) OsAM1 is required for leptotene-zygotene transition in rice. Cell Res.21 :654–665.</ref>
 +
<ref name="ref4">Tomoya S. Kitajima1, Shigehiro A. Kawashima1,Yoshinori Watanabe1.(2004) The conserved kinetochore protein shugoshin protects centromeric cohesion during meiosis. Nature. 427 :510–517.</ref>
 +
<ref name="ref5">Kiburz, B.M., Reynolds, D.B., Megee, P.C., et.al. (2005) The core centromere and ''Sgo1'' establish a 50-kb cohesin-protected domain around centromeres during meiosis I. EMBO J. 22 :3017-3030.</ref>
 +
<ref name="ref6">Vahan B. Indjeian, Bodo M. Stern, Andrew W. Murray. (2005) OsAM1 is required for leptotene-zygotene transition in rice. Science. 307 :130–133.</ref>
 +
<ref name="ref7">Olivier Hamant, Inna Golubovskaya, Robert Meeley, et.al. (2005) A REC8-Dependent Plant Shugoshin Is Required for Maintenance of Centromeric Cohesion during Meiosis and Has No Mitotic Functions. Current Biology. 15 : 948–954.</ref>
 +
<ref name="ref8">Kerrebrock, A.W., Miyazaki, W.Y., Birnby, D, et.al. (1992) The Drosophila mei-S332 gene promotes sister-chromatid cohesion in meiosis following kinetochore differentiation. Genetics, 130:827.</ref>
 +
<ref name="ref9">Kerrebrock, A.W., Moore, D.P., Wu, J.S, et.al. (1995) Mei-S332, a Drosophila protein required for sister-chromatid cohesion, can localize to meiotic centromere regions. Cell, 83:247.</ref>
 +
<ref name="ref10">Watanabe, Y. (2005) Shugoshin: guardian spirit at the centromere. Curr. Opin. Cell Biol. 17: 590–595.</ref>
 +
<ref name="ref11">Tang, T.T.L., Bickel, S.E., Young, L.M. , et.al. (1998) Maintenance of sister-chromatid cohesion at the centromere by the Drosophila MEI-S332 protein. Genes Dev,12: 3843.</ref>
 +
 
 +
</references>
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
 
GeneName = Os02g0799100|
 
Description = Hypothetical protein|
 
Version = NM_001186253.1 GI:297721638 GeneID:9266998|
 
Length = 3610 bp|
 
Definition = Oryza sativa Japonica Group Os02g0799100, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 2|Chromosome 2]]|
 
AP = Chromosome 2:34917690..34921299|
 
CDS = 34920472..34920601,34920706..34920743,34920892..34921040,34921133..34921148|
 
GCID = <gbrowseImage1>
 
name=NC_008395:34917690..34921299
 
source=RiceChromosome02
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008395:34917690..34921299
 
source=RiceChromosome02
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggcggccgctgcaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggagaacgccaagttgcgtcatctgcttgctgagcgaaacaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattag</cdnaseq>|
 
AA = <aaseq>MAAAAGAAARGGGVIPAGKGGSLRSPGKPVVLADITNTGRPNPT                    GSVHAIADVLKENAKLRHLLAERNKVIEVSRVELQKIRLALQAMQQKNLQLVQANSQM                    FAVCLLIH</aaseq>|
 
DNA = <dnaseqindica>699..828#557..594#260..408#152..167#tctccgaaacctcatcggattcctctccgcgcggctaccggagcgccgcctctctctccccgcgcgcgcgctgcggctccgagggtcctcgccggcttcacctccggcggtggcgtgcgcaaccacaggccccgcggccgctgggccagccatggcggccgctgcaggtaaaaatcgtatcccctagatttcgagctacccgtggcattccatggtggggttctctcgggctcagcttccgcacctcctcctaaaccaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggtgatttcagttctagctctattttttttttcttcgggggatttcggttctaactcaaacaagcagacaaccctagcagcgccaagttgaatgctagtaattccgatttccatccgattaaaccatttaattcctcccttgctttcaggagaacgccaagttgcgtcatctgcttgctgagcgaaagtatgcattgcctctaccatccattttgttgtcggaggataaaacctgcggtttctcaagtagcacagttttttttaaattattttttgctttcttatttgcagcaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattagctccctacctcaccattcttgtgtcaatgtttgtttatacttgtgcaatgctggttcaccaggcctgtaggttgagcacatagtttgagttatagctatgcataatggcaaatgagaagtgtttgtcttacttcattgctgattgttttgtggtagttacagactgtttgatatgtctatgttttcttcttccttgcaggaaataaatcaaggaaaagatagagtaagctgcctctggttctttgttgtttgaattttcaaatgcagtatgatttctgatttggggattaatctgtggatatgacatgcagatcaagttattgcaacatgaacttgcatgcacaatagccgtgctcaaagtaaagggttctgaactcgaggtaattctaaagcttgactgtatgaacctctgtttgttacatataacatgcttttctcatcgtctactattgcagaagatgagtaagacttctaacaatcaacaaaatagagcaaagatattggtatgcagtcaaattcttaagcaaatgattcaccatgtttagctgcattatttctagttctgaattctgaaatcgttctgttcgtgcaacataatcaggagaaaaaaaccaggtcttccaaatgcgcaccaactaaggctcatcaaatggctgcaggttctattagagaacatttggttgaaattcaatgtaatgctcactcttctcactatttctttcttgaactagatactatacctggcaatcgtttcatctatcctactttatggttataatttaccccctttatatgaagcaattgaagttttatgttttttcctctgccataagttaggacactagtaaaattctaatcttcatttgttgccaatttcttctcagcagctgtgccatcttatactagctgtcatgagcctccacaggataaaacaaacaagaggtattttcatctctttactgatgtttgagtgggtgactggttgaccgggttatagtagcctatttcatgcatcactacttattcagcatgtttgcaaacaggtgcacaaataggcggaagtcagaatcatgtgaagttacaatggataccaacacagtgcaacatagctgcagacctcatgtggaatataatgggtcatcgcatgatgatgatccaaggtaatcaatgcttaatgcttataacagaatgcgttcattgttgcatcattatctgatttaagcttgttcaaaactcttgggcacatgtggtcagaaaaactcgacggagaaggtctgccagattgaaccctggatcttttgaggtcgcagagatctgtgataaattgcatgaggatgctactgttccttcggctcctagttctaatgttccaaagctgcaggaaccaaatgctggaaaagatatggtagggttttactatttctttctgtttttctgtttcaaaaaaaatttcacaatgtggttatgattttgtgctagatttgtggtggcaagatgaagtcattgcaaaaagaacttccatgtgatgcaatagcgcaagtagtagaggctccagaactcaaggtaattgagcagagtggttcgcatcaaatttttgctagtcttacatatattaatttattttttagtaaaatctggatcctgattgtatgtactagaaaaaacgaagtatgcacacacaaaaggaagtgtatctggaggtgggcaggacagttcttatgtaaataatcctcacatttatccatgaagaagtcttaattcttattatgttcctacttctttcgtccaatgaaattaggagatacaagaagcaggttccagcgttgctggaggtgaggcgcataaatttgatattgaggatccagagccaccaaggtatggcacatcattttagcagggtttaagatgcatggtacatcacacaattcacctaaacaatatgctctgtccaatcagaaaatcaatgcgtattgatgcaaacaaacggaagctggaatcatttgagagtcgattggcctcgaacaaagaggactgcatcaatgccatatgcgactcaacttcaagcgtgccaattcagcatgaacaaaagaggtaactctctcctatattccaacgatgcactttcctctgcatggaacatgtcaatcatggctgcccttaatactgcagaaaattgtcaaggagaaaatcctcaagactggaccctggaccttgggaggtcacaaatggcacttttgaaattgtccaggaagatacagttgccccgtctgctccttccagttcaaatgctttgatcgagcagaccaaaaatgatatgcaaaacgaccgcagttgctcgactaaaccttctgacgagcaggtgataggtagaagatcttcagttgggaggccctcaagacgggcagcagaaaagatagtctcctacaaggaggtgcccttgaatattaagatgcgacgaccatgatccccacttgcatgcaaagagcacaaacaccattggcatttattttatggtgtagaatcaagtttgttgtgtatctatctgttttggtcgctgtcaataggtaggttagctcctctatctaccccaacatggatactcaccctgcatcccagtttcaaactgaccatggaatttatctgatttagcctcagtctggactgatgatgccgataacaaccagcaaaccattgttcctgttctgatgaagtagagaccagacaacaataatgtggttagtactgttttattttcttgatggttctcatatgttgagagatc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001186253.1 RefSeq:Os02g0799100]|
 
}}
 
 
[[Category:Genes]]
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Japonica mRNA]]

Latest revision as of 06:02, 14 May 2015

The Ossgo1gene encodes the protein OsSGO1 which maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis.

Annotated Information

Function

Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments [1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1 [2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition [3]. Overall, OsSGO1 is specifically required to protect centromeric cohesion during meiosis. And OsSGO1 transfers from nucleoli onto centromeres at the onset of prophase in both meiosis and mitosis.Concurrently,The relocalization of OsSGO1 onto centromeres is OsAM1-dependent.The maintenance of SCs in prophase I is affected in Ossgo1 [2].

Mutation

Schematic representation of OsSGO1 gene (from reference [2]).

An OsSGO1-RNAi vector is transformed into rice calli by Agrobacterium-mediated DNA transfer. OsSGO1-RNAi lines is obtained by screening the plants regenerated from the transformed calli by PCR. One single Tos17-insertion mutant line of the OsSGO1 gene, named Ossgo1-1, is identified by screening the public insertion line collections. Sequence analysis of its PCR products confirm that Tos17 is inserted into exon 15, only 5 bp upstream from the stop codon(Figure S1). [2] .

Expression(Mutant VS. Wild type)

Expression analysis of OsSGO1 (from reference [2]).
Characterization of the phenotype of Ossgo1 mutants (from reference [2]).
The defective cDNA sequence from Ossgo1-1 mutant (from reference [2]).
Western blotting analysis of OsSGO1 expression (from reference [2]).

OsSGO1 is expressed most highly in the roots, secondly in the panicles, and at a relatively low level in leaves(Figure S3)[2]. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophase Ⅰand anaphase II, respectively, which finally leads to sterile pollen formation[1]. The homozygous Ossgo1-1 mutant grows normally in the vegetative stage but is sterile during the phase of flowering, and its pollen is completely non-viable when evaluated by 1% I2-KI solution staining (Figure S4). The transcription level of OsSGO1 is slightly decreased in the Ossgo1-1 mutant (Figure S3). Additionally, by performing RT-PCR, it is found that the Ossgo1-1 cDNA sequence is altered downstream of the Tos17-insertion position by adding 71 nucleotides, and the whole cDNA lacks a stop codon (Figure S5). Furthermore, an allelic mutant of Ossgo1-1 with a deletion of 15 bp (nucleotides 1773–1787 in the gene) from the mutants induced by 60 Co~γ-ray radiation is identified and is named as Ossgo1-2 (Figure S1), resulting in five amino acids missing in OsSGO1. The homozygous Ossgo1-2 mutant is also normal in the vegetative stage but completely sterile (Figure S4). Neither of the mutants set seeds when pollinated with pollen from the wild-type plants. In addition, it is found that the expression level of OsSGO1 protein is indeed down-regulated in Ossgo1-1 and OsSGO1RNAi plants through immunoblotting (Figure S5) [2].

Primer Forward primer Reverse primer
Gene amplication 5'-CGAAACCTCATCGGATTCCT-3' 5'-GCCAATGGTGTTTGTGCTCT-3' (used to amplify the predicted coding regions of OsSGO1 [2])
5'-ATTGTTAGGTTGCAAGTTAGTTAAGA' 5'-GCCTCGAACAAAGAGGACTG-3' (used to amplify the Tos17 inserted regions of ossgo1 [2])
5'-GTGAATTCCCATTGAGGATCCAGAGCCACCA-3' 5'-AGTCTCGAGTACCTATCACCTGCTCGTCAGA-3' (used to amplify the fragment of OsSGO1 cDNA [2])
RT-PCR 5'-TCAATCAGCTGTGCCATCTT-3' 5'-CATCTTGCCACCACA AATCA-3' [2]

Evolution

Alignment of OsSGO1 with ZmSGO1 in maize (from reference [2]).

SGO1 gene is the first meiosis specificity expressed gene in yeast cDNA library screening conducted in Watanabe Lab, as well as to the lack of corresponding mutant phenotype analysis, identified as the homologous gene of Drosophila melanogaster Mei - S332 [4][5]. Many researches of SGO function have been investigated in animals and yeast [6], while relatively few has been reported in plants. In plants, SGO1 gene is first found in maize, and the mutant of premature-dissociation centromeric cohesion which locates in the centromere at the stage of anaphase Ⅰ. And the phenotype is due to the deletion of ZmSGO1 protein. ZmSGO1 is found to be located in the centromere from the eptotene stage Previous studies indicates that ZmSGO1 plays an important role in protecting of centromeric cohesion during meiosis I [7]. The OsSGO1 protein sequence,which comprises 486 amino acid residues, shows a high similarity toZmSGO1(209/537 residues identical and 278/537 residues positive(Figure S2)[2].

Knowledge Extension

OsSGO1 is a shugoshin protein. Shugoshin is a conserved protein in eukaryotes that protects the centromeric cohesin of sister chromatids from cleavage by separase during meiosis[2]. Shugoshins (Japanese for ‘guardian spirit’) are the conserved proteins required to protect the cohesin adjacent to the centromeres from cleavage by separase. Drosophila Mei-S332 is the first protein in the shugoshin family to be discovered, which is necessary for chromosome precise separation [4][8][9]. From then, shugoshins have been identified in various organisms from yeast to humans. Saccharomyces cerevisiae and Drosophila have only one kinds of shugoshin, which is expressed in both mitosis and meiosis, while Schizosaccharomyces pombe and mammals have two (Sgo1 and Sgo2) [4][10]. There are two conserved domains in shugoshin proteins: one is the basic region in the C-terminal, which is required for chromosomal localization; the other is the coiled-coil that is located near the N-terminal, which may mediate homodimerization and interactions with other proteins[4][11]. The activity of shugoshin is controlled by an accurate and complicated process during cell divisions. In S. pombe, the location of Sgo1 is regulated by the kinase, Bub1, and its degradation at anaphase I is controlled by the anaphasepromoting complex (APC)[4].SGO1 is loaded onto the chromosome during leptotene, which is much earlier than that in other organisms,in plants such as rice and maize, and it disassociates during anaphase I. ZmSGO1 is reported to localize at both the centromere core and the pericentromeric regions[7].

Labs working on this gene

  • State Key Laboratory of Plant Genomics and Center for Plant Gene Research, Institute of Genetics and Developmental Biology,Chinese Academy of Sciences, Beijing 100101, China
  • Yangzhou University, Yangzhou 225009, Jiangsu Province; Institute of Genetics,Chinese Academy of Sciences, Beijing 100101

References

  1. 1.0 1.1 ChiZhengchang. (2010) Functional Analysis of the Meiotic Gene OsSGO1 in Oryza sativa. Yangzhou university
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 Mo Wang, Ding Tang, Kejian Wang, et.al. (2011) OsSGO1 maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis. The Plant Journal. 67 : 583-594
  3. Che, L., Tang, D., Wang, K., et.al. (2011) OsAM1 is required for leptotene-zygotene transition in rice. Cell Res.21 :654–665.
  4. 4.0 4.1 4.2 4.3 4.4 Tomoya S. Kitajima1, Shigehiro A. Kawashima1,Yoshinori Watanabe1.(2004) The conserved kinetochore protein shugoshin protects centromeric cohesion during meiosis. Nature. 427 :510–517.
  5. Kiburz, B.M., Reynolds, D.B., Megee, P.C., et.al. (2005) The core centromere and Sgo1 establish a 50-kb cohesin-protected domain around centromeres during meiosis I. EMBO J. 22 :3017-3030.
  6. Vahan B. Indjeian, Bodo M. Stern, Andrew W. Murray. (2005) OsAM1 is required for leptotene-zygotene transition in rice. Science. 307 :130–133.
  7. 7.0 7.1 Olivier Hamant, Inna Golubovskaya, Robert Meeley, et.al. (2005) A REC8-Dependent Plant Shugoshin Is Required for Maintenance of Centromeric Cohesion during Meiosis and Has No Mitotic Functions. Current Biology. 15 : 948–954.
  8. Kerrebrock, A.W., Miyazaki, W.Y., Birnby, D, et.al. (1992) The Drosophila mei-S332 gene promotes sister-chromatid cohesion in meiosis following kinetochore differentiation. Genetics, 130:827.
  9. Kerrebrock, A.W., Moore, D.P., Wu, J.S, et.al. (1995) Mei-S332, a Drosophila protein required for sister-chromatid cohesion, can localize to meiotic centromere regions. Cell, 83:247.
  10. Watanabe, Y. (2005) Shugoshin: guardian spirit at the centromere. Curr. Opin. Cell Biol. 17: 590–595.
  11. Tang, T.T.L., Bickel, S.E., Young, L.M. , et.al. (1998) Maintenance of sister-chromatid cohesion at the centromere by the Drosophila MEI-S332 protein. Genes Dev,12: 3843.

Structured Information