|
|
| (10 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| − | {{Mitochondrion|
| + | Please input one-sentence summary here. |
| − | GeneName = atp1|
| |
| − | Function = Involved in the synthesis of ATP
| |
| − | Description = ATP synthase F0 subunit 1|
| |
| − | Version = GeneID:6450183|
| |
| − | Length = 1530 bp|
| |
| − | Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| + | ==Annotated Information== |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| + | ===Function=== |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| + | Please input function information here. |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| + | |
| − | |
| + | ===Expression=== |
| − | Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
| + | Please input expression information here. |
| − | AP = Mitochondrion:352379..353908|
| + | |
| − | CDS = 352379..353908|
| + | ===Evolution=== |
| − | GCID = <gbrowseImage1>
| + | Please input evolution information here. |
| − | name=NC_011033:352379..353908
| + | |
| − | source=Rice_Japonica_Mitochondrion
| + | You can also add sub-section(s) at will. |
| − | preset=GeneLocation
| + | |
| − | </gbrowseImage1>|
| + | ==Labs working on this gene== |
| − | GSID = <gbrowseImage2>
| + | Please input related labs here. |
| − | name=NC_011033:352379..353908
| + | |
| − | source=Rice_Japonica_Mitochondrion
| + | ==References== |
| − | preset=GeneLocation
| + | Please input cited references here. |
| − | </gbrowseImage2>|
| + | |
| − | AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
| + | ==Structured Information== |
| − | DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]] |
| − | Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Mitochondrion]] | |
| − | [[Category:Mitochondrion]]
| |
Please input one-sentence summary here.
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information