|
|
| (9 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| − | {{Mitochondrion|
| + | Please input one-sentence summary here. |
| − | GeneName = atp1|
| |
| − | Function = Involved in the synthesis of ATP|
| |
| − | Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the
| |
| − | rice mitochondrial atp1 gene is also regulated in different ways.|
| |
| − |
| |
| − | Description = ATP synthase F0 subunit 1|
| |
| − | Version = GeneID:6450183|
| |
| − | Length = 1530 bp|
| |
| − | Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| + | ==Annotated Information== |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| + | ===Function=== |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| + | Please input function information here. |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| + | |
| − | |
| + | ===Expression=== |
| − | Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
| + | Please input expression information here. |
| − | AP = Mitochondrion:352379..353908|
| + | |
| − | CDS = 352379..353908|
| + | ===Evolution=== |
| − | GCID = <gbrowseImage1>
| + | Please input evolution information here. |
| − | name=NC_011033:352379..353908
| + | |
| − | source=Rice_Japonica_Mitochondrion
| + | You can also add sub-section(s) at will. |
| − | preset=GeneLocation
| + | |
| − | </gbrowseImage1>|
| + | ==Labs working on this gene== |
| − | GSID = <gbrowseImage2>
| + | Please input related labs here. |
| − | name=NC_011033:352379..353908
| + | |
| − | source=Rice_Japonica_Mitochondrion
| + | ==References== |
| − | preset=GeneLocation
| + | Please input cited references here. |
| − | </gbrowseImage2>|
| + | |
| − | AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
| + | ==Structured Information== |
| − | DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]] |
| − | Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Mitochondrion]] | |
| − | [[Category:Mitochondrion]]
| |
Please input one-sentence summary here.
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
