|
|
| (7 intermediate revisions by 3 users not shown) |
| Line 1: |
Line 1: |
| − | {{Mitochondrion|
| + | Please input one-sentence summary here. |
| − | GeneName = atp1|
| |
| − | Annotated Information = protein coding; the gene of protein Atp1(ATP synthase F0 subunit 1).|
| |
| − | Function = Involved in the synthesis of ATP|
| |
| − | Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the
| |
| − | rice mitochondrial atp1 gene is also regulated in different ways.|
| |
| − | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
| |
| − | Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
| |
| − | References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
| |
| − | Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
| |
| − | Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
| |
| − | Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
| |
| − | Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
| |
| − | Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
| |
| − | Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
| |
| − | Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from< i> Camellia sinensis</i> related to selenium or sulfur metabolism and functional expression in< i> Escherichia coli</i>[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
| |
| − | Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
| |
| − | Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|
| |
| | | | |
| − | Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
| + | ==Annotated Information== |
| − | Description = ATP synthase F0 subunit 1|
| + | ===Function=== |
| − | Version = GeneID:6450183|
| + | Please input function information here. |
| − | Length = 1530 bp|
| |
| − | Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| + | ===Expression=== |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| + | Please input expression information here. |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| + | |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| + | ===Evolution=== |
| − | |
| + | Please input evolution information here. |
| − | Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
| + | |
| − | AP = Mitochondrion:352379..353908|
| + | You can also add sub-section(s) at will. |
| − | CDS = 352379..353908|
| + | |
| − | GCID = <gbrowseImage1>
| + | ==Labs working on this gene== |
| − | name=NC_011033:352379..353908
| + | Please input related labs here. |
| − | source=Rice_Japonica_Mitochondrion
| + | |
| − | preset=GeneLocation
| + | ==References== |
| − | </gbrowseImage1>|
| + | Please input cited references here. |
| − | GSID = <gbrowseImage2>
| + | |
| − | name=NC_011033:352379..353908
| + | ==Structured Information== |
| − | source=Rice_Japonica_Mitochondrion
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]] |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
| |
| − | DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Mitochondrion]] | |
| − | [[Category:Mitochondrion]]
| |
