Difference between revisions of "Atp1"

From RiceWiki
Jump to: navigation, search
 
(4 intermediate revisions by one other user not shown)
Line 10: Line 10:
 
===Evolution===
 
===Evolution===
 
Please input evolution information here.
 
Please input evolution information here.
 
  
 
You can also add sub-section(s) at will.
 
You can also add sub-section(s) at will.
Line 21: Line 20:
  
 
==Structured Information==
 
==Structured Information==
{{Mitochondrion|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]]
GeneName = atp1|
 
Annotated Information = protein coding; the gene of protein Atp1(ATP synthase F0 subunit 1).|
 
Function = Involved in the synthesis of ATP|This is one of the mitochondrial-encoded genes, which encodes one of the ATP sythases of the respiratory chain.Encode the αsubunit of F1.
 
Expression = With the in vitro capping method, ribonuclease protection experiments and from primer extension analysis, it has been prove that rice atp1 is transcribed from multiple initiation sites.Further experiments prove that there are at least eight transcription initiation sites of the rice mitochondrial atp1 gene. This only exist in rice atp1 gene, which are different from other plant species, such as wheat , maize and ''Oenothera''. Rice atp1 is present in a unique environment and is transcribed at a high level.  The multiple initiation sites of the rice mitochondrial atp1 gene is also regulated in different ways.|
 
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|During the evolution peocess, the majarity of the mitochondria genetics content were transferred into the nucleus of the cell.Mitochondrial biogenesis today relies on the coordinated regulation of both the nuclear genomes and the mitochondrial genomes. So the expression of rice atp1 now is influence by bothe the nuclear genomes and the mitochondrial genomes.
 
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|Laboratory of Radiation Genetics, Faculty of Agriculture, The University
 
of Tokyo. Laboratory of Plant Breeding, Faculty of Agriculture, The University
 
of Tokyo.
 
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
 
            Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
 
            Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
 
            Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
 
            Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
 
            Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
 
            Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
 
            Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from< i> Camellia sinensis</i> related to selenium or sulfur metabolism and functional expression in< i> Escherichia coli</i>[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
 
            Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
 
            Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|
 
            Mikio Nakazono, Mayuko Ishikawa, et al. Multiple initiation sites for transcription of a gene
 
for subunit 1 of F1-ATPase (atp1 ) in rice mitochondria[J]. Curr Genet, 1996, 29: 417-422.
 
            Catherine Colas des Francs-Small, Ian Small. Surrogate mutants for studying mitochondrially encoded functions[J]. Biochimie, 2014, 234-242.
 
            Kamel Hammani, Philippe Giege. RNA metabolism in plant mitochondria[J]. Trends in plant sciences, 2014, 19: 380-389.
 
 
 
Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
 
Description = ATP synthase F0 subunit 1|
 
Version = GeneID:6450183|
 
Length = 1530 bp|
 
Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
 
Source = Oryza sativa Japonica Group
 
 
 
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
 
AP = Mitochondrion:352379..353908|
 
CDS = 352379..353908|
 
GCID = <gbrowseImage1>
 
name=NC_011033:352379..353908
 
source=Rice_Japonica_Mitochondrion
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_011033:352379..353908
 
source=Rice_Japonica_Mitochondrion
 
preset=GeneLocation
 
</gbrowseImage2>|
 
AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
 
DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Mitochondrion]]
 
[[Category:Mitochondrion]]
 

Latest revision as of 05:33, 15 May 2015

Please input one-sentence summary here.

Annotated Information

Function

Please input function information here.

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information