|
|
| (18 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| − | {{JaponicaGene|
| + | Please input one-sentence summary here. |
| − | GeneName = Os05g0429900|
| + | |
| − | Description = Similar to MybHv5 (Fragment)|
| + | ==Annotated Information== |
| − | Version = NM_001187510.1 GI:297724150 GeneID:9266213|
| + | ===Function=== |
| − | Length = 1279 bp|
| + | This gene may principally play roles in early heat response in rice. |
| − | Definition = Oryza sativa Japonica Group Os05g0429900, complete gene.|
| + | |
| − | Source = Oryza sativa Japonica Group
| + | ===Expression=== |
| | + | MYBS3 activated cold signaling pathway in rice. Some research showed that, among 27 HR Myb genes, 17 genes were early activated, two (Os02g0624300 and Os05g0429900)were continuously up-regulated. |
| | + | |
| | + | ===Evolution=== |
| | + | Please input evolution information here. |
| | + | |
| | + | You can also add sub-section(s) at will. |
| | + | |
| | + | ==Labs working on this gene== |
| | + | Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China |
| | + | College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China |
| | + | Center of Analysis and Testing, Hunan Agricultural University, Changsha, China |
| | + | |
| | + | ==References== |
| | + | Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192. |
| | + | |
| | + | ==Structured Information== |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 5|Chromosome 5]]|
| |
| − | AP = Chromosome 5:21106104..21107382|
| |
| − | CDS = 21106375..21106894,21106995..21107257|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatga</cdnaseq>|
| |
| − | AA = <aaseq>MGRSPCCEKAHTNKGAWTKEEDQRLIAYIRAHGEGCWRSLPKAA GLLRCGKSCRLRWMNYLRPDLKRGNFTDDEDELIIRLHSLLGNKWSLIAGQLPGRTDN EIKNYWNTHIKRKLLARGIDPQTHRPLLSGGDGIAASNKAAPPPPHPISVPAKAAAAA IFAVAKPPPPPRPVDSSDDGCRSSSGTTSTGEPRCPDLNLELSVGPTPSSPPAETPTS ARPVCLCYHLGFRGGEACSCQADSKGPHEFRYFRPLEQGQYI</aaseq>|
| |
| − | DNA = <dnaseqindica>489..1008#126..388#ccgccgcggctcacctggaaactgggcagattggacaatcgctcgagcgagctagcgagagagagcgcgagagagcgaggcggcgcgcgcggtggttgcggatttgtagcttagagcgcggggccatggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtcagtctccctccccccgtctccggcgccgccgccaccgatcgatggagcattcatcaattccttgtgattctcaattcggtttcgcttcttctttcaggtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatgagatatgaccatgagatgtgagatggcttaattagcttcaattcccaacatgtgtaacacagggagtttttctagtggacgacaatactgtttaatttcagaaaaaaaaagggaaagaaaaaggttctaatctgttcatatttcttactattatccaatcttcatgatctcaatctctctctctctttattatttttctttgtagtaattaacttcatgttggttcctctaaaaaagattggtcgatgttattcagtgataaatattcctag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001187510.1 RefSeq:Os05g0429900]|
| |
| − | }}
| |
| | [[Category:Genes]] | | [[Category:Genes]] |
| | [[Category:Japonica mRNA]] | | [[Category:Japonica mRNA]] |
Please input one-sentence summary here.
Annotated Information
Function
This gene may principally play roles in early heat response in rice.
Expression
MYBS3 activated cold signaling pathway in rice. Some research showed that, among 27 HR Myb genes, 17 genes were early activated, two (Os02g0624300 and Os05g0429900)were continuously up-regulated.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China
College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China
Center of Analysis and Testing, Hunan Agricultural University, Changsha, China
References
Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192.
Structured Information
