|
|
| (15 intermediate revisions by one other user not shown) |
| Line 3: |
Line 3: |
| | ==Annotated Information== | | ==Annotated Information== |
| | ===Function=== | | ===Function=== |
| − | Please input function information here.
| + | This gene may principally play roles in early heat response in rice. |
| | | | |
| | ===Expression=== | | ===Expression=== |
| − | Prediction
| + | MYBS3 activated cold signaling pathway in rice. Some research showed that, among 27 HR Myb genes, 17 genes were early activated, two (Os02g0624300 and Os05g0429900)were continuously up-regulated. |
| − | of subcellular targeting by using the TargetP and WoLF
| |
| − | PSORT prediction programs suggested that Os01g0919900,
| |
| − | Os01g0880800, and Os08g0199400 are localized in the chloplast
| |
| − | or mitochondrion, whereas the others are present in
| |
| − | chloroplasts.
| |
| − | | |
| − | [[File:zxq1.png|200px|thumb|left|Fig. 1. RNA blot analysis.]]
| |
| | | | |
| | ===Evolution=== | | ===Evolution=== |
| Line 21: |
Line 14: |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| − | Please input related labs here.
| + | Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China |
| | + | College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China |
| | + | Center of Analysis and Testing, Hunan Agricultural University, Changsha, China |
| | | | |
| | ==References== | | ==References== |
| − | Please input cited references here.
| + | Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192. |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| |
| − | GeneName = Os05g0429900|
| |
| − | Description = Similar to MybHv5 (Fragment)|
| |
| − | Version = NM_001187510.1 GI:297724150 GeneID:9266213|
| |
| − | Length = 1279 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os05g0429900, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 5|Chromosome 5]]|
| |
| − | AP = Chromosome 5:21106104..21107382|
| |
| − | CDS = 21106375..21106894,21106995..21107257|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatga</cdnaseq>|
| |
| − | AA = <aaseq>MGRSPCCEKAHTNKGAWTKEEDQRLIAYIRAHGEGCWRSLPKAA GLLRCGKSCRLRWMNYLRPDLKRGNFTDDEDELIIRLHSLLGNKWSLIAGQLPGRTDN EIKNYWNTHIKRKLLARGIDPQTHRPLLSGGDGIAASNKAAPPPPHPISVPAKAAAAA IFAVAKPPPPPRPVDSSDDGCRSSSGTTSTGEPRCPDLNLELSVGPTPSSPPAETPTS ARPVCLCYHLGFRGGEACSCQADSKGPHEFRYFRPLEQGQYI</aaseq>|
| |
| − | DNA = <dnaseqindica>489..1008#126..388#ccgccgcggctcacctggaaactgggcagattggacaatcgctcgagcgagctagcgagagagagcgcgagagagcgaggcggcgcgcgcggtggttgcggatttgtagcttagagcgcggggccatggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtcagtctccctccccccgtctccggcgccgccgccaccgatcgatggagcattcatcaattccttgtgattctcaattcggtttcgcttcttctttcaggtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatgagatatgaccatgagatgtgagatggcttaattagcttcaattcccaacatgtgtaacacagggagtttttctagtggacgacaatactgtttaatttcagaaaaaaaaagggaaagaaaaaggttctaatctgttcatatttcttactattatccaatcttcatgatctcaatctctctctctctttattatttttctttgtagtaattaacttcatgttggttcctctaaaaaagattggtcgatgttattcagtgataaatattcctag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001187510.1 RefSeq:Os05g0429900]|
| |
| − | }}
| |
| | [[Category:Genes]] | | [[Category:Genes]] |
| | [[Category:Japonica mRNA]] | | [[Category:Japonica mRNA]] |
Please input one-sentence summary here.
Annotated Information
Function
This gene may principally play roles in early heat response in rice.
Expression
MYBS3 activated cold signaling pathway in rice. Some research showed that, among 27 HR Myb genes, 17 genes were early activated, two (Os02g0624300 and Os05g0429900)were continuously up-regulated.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China
College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China
Center of Analysis and Testing, Hunan Agricultural University, Changsha, China
References
Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192.
Structured Information