|
|
| (2 intermediate revisions by one other user not shown) |
| Line 14: |
Line 14: |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| | + | Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China |
| | + | College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China |
| | + | Center of Analysis and Testing, Hunan Agricultural University, Changsha, China |
| | | | |
| | ==References== | | ==References== |
| − | Chang-Jie Jiang,1 Masaki Shimono,1 Satoru Maeda,1 Haruhiko Inoue,1 Masaki Mori,1Morifumi Hasegawa,2 Shoji Sugano,1 and Hiroshi Takatsuji1.Suppression of the Rice Fatty-Acid Desaturase Gene OsSSI2 Enhances Resistance to Blast and Leaf Blight Diseases in Rice.MPMI 2009,22(7): 820–829.
| + | Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192. |
| − | | |
| − | Hui-Yuan Ya, Qiu-Fang Chen, Wei-Dong Wang, Guang-Yong Qin, and Zhen Jiao.Pathway Analysis of the Differentially Expressed Genes in Oryza Sativa Exposed to the Implantation of Low-Energy Nitrogen Ion.International Journal of Bioscience, Biochemistry and Bioinformatics, 2011,1( 2 ):89-97.
| |
| − | | |
| − | Liebo Shu1, Qiaojun Lou, Chenfei Ma, Wei Ding, Jia Zhou, Jinhong Wu, Fangjun Feng,Xin Lu, Lijun Luo, Guowang Xu� and Hanwei Mei.Genetic, proteomic and metabolic analysis of the regulation of energy storage in rice seedlings in response to drought.Proteomics 2011, 11: 4122–4138.
| |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| |
| − | GeneName = Os05g0429900|
| |
| − | Description = Similar to MybHv5 (Fragment)|
| |
| − | Version = NM_001187510.1 GI:297724150 GeneID:9266213|
| |
| − | Length = 1279 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os05g0429900, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 5|Chromosome 5]]|
| |
| − | AP = Chromosome 5:21106104..21107382|
| |
| − | CDS = 21106375..21106894,21106995..21107257|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008398:21106104..21107382
| |
| − | source=RiceChromosome05
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatga</cdnaseq>|
| |
| − | AA = <aaseq>MGRSPCCEKAHTNKGAWTKEEDQRLIAYIRAHGEGCWRSLPKAA GLLRCGKSCRLRWMNYLRPDLKRGNFTDDEDELIIRLHSLLGNKWSLIAGQLPGRTDN EIKNYWNTHIKRKLLARGIDPQTHRPLLSGGDGIAASNKAAPPPPHPISVPAKAAAAA IFAVAKPPPPPRPVDSSDDGCRSSSGTTSTGEPRCPDLNLELSVGPTPSSPPAETPTS ARPVCLCYHLGFRGGEACSCQADSKGPHEFRYFRPLEQGQYI</aaseq>|
| |
| − | DNA = <dnaseqindica>489..1008#126..388#ccgccgcggctcacctggaaactgggcagattggacaatcgctcgagcgagctagcgagagagagcgcgagagagcgaggcggcgcgcgcggtggttgcggatttgtagcttagagcgcggggccatggggaggtcgccgtgctgcgagaaggcgcacacgaacaagggggcgtggacgaaggaggaggaccagcggctcatcgcgtacatcagggcgcatggcgaaggctgctggcgctcgctgcccaaggcggcgggcctccttcgctgcggcaagagctgccgcctccggtggatgaactacctccgccccgacctcaagcgcggcaacttcaccgacgacgaggacgagctcatcatccgcctccacagcctcctcggcaacaagtcagtctccctccccccgtctccggcgccgccgccaccgatcgatggagcattcatcaattccttgtgattctcaattcggtttcgcttcttctttcaggtggtctctgatcgccgggcagctgccggggaggacggacaacgagatcaagaactactggaacacgcacatcaagcgcaagctcctcgcccgcggcatcgacccgcagacgcaccgcccgctgctcagcggcggtgacggcatcgcggcgagcaacaaggcggcaccaccgccgccgcatcccatatccgtcccggcgaaggcggcggccgcggcgatcttcgccgtggcgaagccgccgccgccgccgcgcccggtcgactcctcggacgacggctgccgcagcagcagcggcacaacgagcacgggggagccgcggtgccccgacctcaacctcgagctctcggtcgggccgacgccgagctcgccgccggcggagacgcccaccagcgcgcggccggtctgcctctgctaccacctcggcttccgcggcggggaggcgtgcagctgtcaggctgacagcaagggcccacacgagtttagatatttcaggccgttggaacaaggccagtacatatgagatatgaccatgagatgtgagatggcttaattagcttcaattcccaacatgtgtaacacagggagtttttctagtggacgacaatactgtttaatttcagaaaaaaaaagggaaagaaaaaggttctaatctgttcatatttcttactattatccaatcttcatgatctcaatctctctctctctttattatttttctttgtagtaattaacttcatgttggttcctctaaaaaagattggtcgatgttattcagtgataaatattcctag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001187510.1 RefSeq:Os05g0429900]|
| |
| − | }}
| |
| | [[Category:Genes]] | | [[Category:Genes]] |
| | [[Category:Japonica mRNA]] | | [[Category:Japonica mRNA]] |
Please input one-sentence summary here.
Annotated Information
Function
This gene may principally play roles in early heat response in rice.
Expression
MYBS3 activated cold signaling pathway in rice. Some research showed that, among 27 HR Myb genes, 17 genes were early activated, two (Os02g0624300 and Os05g0429900)were continuously up-regulated.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Key Laboratory for Crop Germplasm Innovation and Utilization of Hunan Province, Hunan Agricultural University, Changsha, China
College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, China
Center of Analysis and Testing, Hunan Agricultural University, Changsha, China
References
Xianwen Zhang , Wirat Rerksiri, Ailing Liu , Xiaoyun Zhou , Hairong Xiong , Jianhua Xiang ,Xinbo Chen , Xingyao Xiong.Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf.Gene, 2013,530: 185–192.
Structured Information
