Difference between revisions of "Os10g0542100"

From RiceWiki
Jump to: navigation, search
(Expression)
(Expression)
 
(22 intermediate revisions by 5 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice '''''Os10g0542100''''' was  first identified as '''''OsMT-II-1a''''' in 2005 by the researchers from Tsinghua University <ref name="ref1" />.
 +
==Background==
 +
* Metallothioneins (MTs) are defined as a class of evolutionally conserved, low molecular-weight, cysteine-rich, metal-binding proteins. Since MTs were firstly purified from horse kidney as Cd-binding proteins in 1956, they have been widely found in diverse organisms including fungi, plants, mammals and cyanobacteria. Unlike in animals, only EcMT from wheat germ and MT1, MT2 and MT3 from Arabidopsis have been purified in plants. In most cases, however, the presence of proteins has been largely inferred from DNA sequence, so the term MT-like proteins is preferred for plant MTs. Plant MT-like proteins are divided into three major classes (class I, II and III), which are distinguishable on the basis of the distribution of cysteine residues in their sequence. Class I MTs are monomers with two cysteine-rich clusters separated by a central cysteine free spacer.
 +
* Most of the deduced products of MT genes identified in both monocots and dicots belong to class I. Based on the arrangement of cysteine residues, plant class I MT proteins have been subdivided into several types.Class II MTs are translational monomers in which cysteine residues are scattered throughout the entire sequence, lacking the internal spacer. This class of protein is exemplified by the wheat EcMT(formerly cysteine-labeled metallothionein) protein, the first characterized plant MT protein. Class III MTs are non-translationally synthesized polypeptides based on repeating units of g-glutamlcysteine (g-Glu-Cys), and are broadly found in the plant kingdom including algae and certain fungi.
 +
* On the other hand, Cobbett and Goldsbrough (2002) proposed a classification system which was able to place the known plant MT proteins into four types based on amino acid sequence. Based on their nomenclature, the class II MT-like protein (OsMT-II) described in this paper may be classified as type 4 MT. Recently, the number of plant MT genes discovered has increased dramatically, and many have not been included in these four types. Because the former nomenclature of three classes can accommodate for an increasing number of plant MTs to be subdivided into different types, we tend to regard the OsMT-like protein described in this paper asclass II MT.
  
==Annotated Information==
+
==Annotated Information==
  This genomic fragment encoding a characteristic metallothionein (MT) protein. The predicted amino acid sequence was shown to have structural features characteristic of plant class II MT proteins.  
+
===Function===
 +
* This genomic fragment encoding a characteristic metallothionein (MT) protein, and its full-length cDNA was isolated from rice developing seeds by RT-PCR. This cDNA, designated OsMT-II-1a, contains an open reading frame of 264 bp encoding a protein of 87 amino acid residues. The predicted amino acid sequence was shown to have structural features characteristic of plant class II MT proteins. Accumulation of OsMT-II-1a mRNA is specifically abundant in developing seeds and 2-day glumes after pollination, and OsMT-II-1a transcription can markedly be induced by H2O2, paraquat, SNP, ethephon, ABA and SA, but barely by metal ions or other exogenous abiotic factors such as low temperature and PEG. The processes of pollination and seed development might be mediated, at least in part, by expression of the OsMT-II-1a gene that is regulated by several abiotic factors.
 +
[[File:function-1.jpg|400px|thumb|right|'''Figure 1''' '' Northern blot analysis of OsMT-II-1a under different metal ion treatments.'']]
 +
* Recently, several studies indicated that plant MT-like proteins, especially the characterized plant class II MT-like proteins, are also involved in important developmental processes showed that the 50-flanking genomic DNA for the wheat EcMT gene contains a core sequence in the 50-flanking region known to be an ABA-responsive element (ABARE), but does not contain metal-responsive elements seen in animal MT genes. Consistent with this, accumulation of the EcMT mRNA is strongly induced during development of immature embryos but not during germination of mature wheat embryos unless ABA is added to the germination medium. Also, supplementation of the medium with zinc does not induce accumulation of EcMT mRNA in germination embryos.
 +
* Accumulation of OsMT-II-1a mRNA is specifically abundant in developing seeds and 2-day glumes after pollination. However, embryogenesis is a complex process regulated by the developmental program and aimed at the formation of viable seeds able to germinate under appropriate environmental conditions. ABA and active oxygen species are postulated to play an important role in many processes of embryogenesis. Also, a hallmark of MT gene regulation is their inducibility by different endogenous and exogenous factors acting directly or indirectly on multiple cis-acting motifs in the regulatory regions of MT genes.
 +
* On the basis of the above results and previous studies, we further propose that the OsMT-II-1a protein not only shares similar roles with wheat EcMT protein in storing metal ions that are required during germination, but might also be involved in providing metal ions to maturing pollen grains since some metals, such as Cu, Zn and Fe, are essential micronutrient elements required for a variety of processes in cellular metabolism and serve as structural and catalytic components of proteins and enzymes. The latter proposal is further supported by results showing that the transcript abundance of OsMT-II-1a can be detected by treatment with ethephon, but it is barely detectable in the rachises, stems, sheaths, leaves and roots.
  
===Function===
+
* It should be noted that ethylene can also modulate the expression of OsMT-II-1a. What is the relationship between metal ions, OsMT-II-1a expression and ethylene during embryogenesis? Results from recent studies indicated that metal ions are involved in ethylene perception and signal transduction by binding to the receptor. In our opinion, it is possible that application of exogenous ethephon may result in an increased usage of metal ions, thereby lowering the cellular metal ion pool.
Plant MTs have been suggested to play important roles in maintaining the homoeostasis of essential transition metals, detoxification of toxic metals, and protecting against intercellular oxidative stress. Moreover, the diverse expression patterns of MT genes suggest that MT-like protein isoforms may differ in sequence, as well as in the functions that these perform in specific tissues. A number of investigations demonstrated these to have distinct but overlapping functions in the multigene family in single species. Recently, several studies indicated that plant MT-like proteins, especially the characterized plant class II MT-like proteins, are also involved in important developmental processes showed that the 50-flanking genomic DNA for the wheat EcMT gene contains a core sequence in the 50-flanking region known to be an ABA-responsive element (ABARE), but does not contain metal-responsive elements seen in animal MT genes. Consistent with this, accumulation of the EcMT mRNA is strongly induced during development of immature embryos but not during germination of mature wheat embryos unless ABA is added to the germination medium. Also, supplementation of the medium with zinc does not induce accumulation of EcMT mRNA in germination embryos.
+
* This in turn increases OsMT-II-1a expression and enhances the transport of metal ions that is required during germination and maturation of pollen grains. On the other hand, ethylene can enhance the production of active oxygen species, which in turn can induce the OsMT-II-1a gene expression. Whether ethylene modulates the expression of OsMT-II-1a alone or in conjunction with other signaling molecules such as active oxygen species remains to be further investigated. Furthermore, a variety of oxidants such as H2O2, SNP and paraquat are involved in the regulation of MT gene expression by inducing disulfide formation. Comparison with the presence of putative ARE in the 50-flanking region raises the question of whether oxidants induce the expression of OsMT-II-1a by oxidizing MT cysteines, by ARE, or by both of them together. Further analysis is required to evaluate the relationship between oxidants and OsMT-II-1a expression. Additionally, SA treatments can markedly enhance H2O2 production, which suggests that SA-mediated H2O2 production may result in OsMT-II-1a expression. Previous studies indicated that accumulation of EcMT mRNA can be induced strongly by ABA. Our results presented here are in line with their findings, showing that in both roots and shoots, the transcription of OsMT-II-1a gene is markedly induced by ABA.
Accumulation of OsMT-II-1a mRNA is specifically abundant in developing seeds and 2-day glumes after pollination. However, embryogenesis is a complex process regulated by the developmental program and aimed at the formation of viable seeds able to germinate under appropriate environmental conditions. ABA and active oxygen species are postulated to play an important role in many processes of embryogenesis. Also, a hallmark of MT gene regulation is their inducibility by different endogenous and exogenous factors acting directly or indirectly on multiple cis-acting motifs in the regulatory regions of MT genes. Therefore, to investigate whether embryogenesis-related signal molecules (such as ABA and active oxygen species) or other exogenous factors (such as PEG, SA, ethylene, heat shock, low temperature, wounding and etiolation) are involved in the regulation of the OsMT-II-1a gene, rice seedlings treated with the above stress factors were harvested, and the transcriptional levels of OsMT-II-1a gene were determined by northern analysis. The effects of ABA, paraquat, SA and SNP were most dramatic in roots, whereas the transcript levels of OsMT-II-1a were low after treatments of H2O2, ethephon, heat shock and etiolation. In shoots, OsMT-II-1a mRNA levels were elevated markedly by treatments with H2O2, ethephon, ABA and SA, but were only slightly induced by treatments with SNP, paraquat, heat shock, low temperature and etiolation. Interestingly, the expression of OsMT-II-1a can be induced, markedly by embryogenesis-related signal molecules (e.g. H2O2 and ABA) or related reagents (e.g. SNP and paraquat), slightly by heat shock, low temperature and etiolation, but hardly by other exogenous factors (e.g. PEG and wounding). These results suggest that the OsMT-II-1a protein may play a role during embryogenesis, but not in response to environmental stresses. On the basis of the above results and previous studies, we further propose that the OsMT-II-1a protein not only shares similar roles with wheat EcMT protein in storing metal ions that are required during germination, but might also be involved in providing metal ions to maturing pollen grains since some metals, such as Cu, Zn and Fe, are essential micronutrient elements required for a variety of processes in cellular metabolism and serve as structural and catalytic components of proteins and enzymes. The latter proposal is further supported by results showing that the transcript abundance of OsMT-II-1a can be detected by treatment with ethephon, but it is barely detectable in the rachises, stems, sheaths, leaves and roots.
 
It should be noted that ethylene can also modulate the expression of OsMT-II-1a. What is the relationship between metal ions, OsMT-II-1a expression and ethylene during embryogenesis? Results from recent studies indicated that metal ions are involved in ethylene perception and signal transduction by binding to the receptor. In our opinion, it is possible that application of exogenous ethephon may result in an increased usage of metal ions, thereby lowering the cellular metal ion pool. This in turn increases OsMT-II-1a expression and enhances the transport of metal ions that is required during germination and maturation of pollen grains. On the other hand, ethylene can enhance the production of active oxygen species, which in turn can induce the OsMT-II-1a gene expression. Whether ethylene modulates the expression of OsMT-II-1a alone or in conjunction with other signaling molecules such as active oxygen species remains to be further investigated.
 
Furthermore, a variety of oxidants such as H2O2, SNP and paraquat are involved in the regulation of MT gene expression by inducing disulfide formation. Comparison with the presence of putative ARE in the 50-flanking region raises the question of whether oxidants induce the expression of OsMT-II-1a by oxidizing MT cysteines, by ARE, or by both of them together. Further analysis is required to evaluate the relationship between oxidants and OsMT-II-1a expression. Additionally, SA treatments can markedly enhance H2O2 production, which suggests that SA-mediated H2O2 production may result in OsMT-II-1a expression. Previous studies indicated that accumulation of EcMT mRNA can be induced strongly by ABA. Our results presented here are in line with their findings, showing that in both roots and shoots, the transcription of OsMT-II-1a gene is markedly induced by ABA. Taken together and comparing with the presence of two putative ABARE (ACGTGCCC), one putative ARE (GCCAAGTCACC) and one putative GCC-box (GCCGCC) found in many pathogen-responsive genes as ethylene-responsive elements in the 50-flanking region of OsMT-II-1a gene, it might be probable that the predicted cis-elements may be involved in the regulation of OsMT-II-1a expression.
 
On the other hand, metal ions have been shown to up-regulate class I MT-like gene expression in plants, and it has also been observed that wheat EcMT protein provides a mechanism for storing zinc that is required during germination. We are interested in whether the expression of class II MT gene is affected by metal ions. To test the effects of metal ions on the gene, OsMT-II-1a transcript accumulation was investigated in shoots of 10-day-old rice seedling exposed to different metal ions at different concentrations. six metal ions, including Fe, Cu, Al, Pb, Cd and Zn, failed to induce distinctly the accumulation of OsMT-II-1a mRNA in shoots, as well as in roots (data not shown). These results coincide with the prediction of existing regulatory cis-elements in its 50-flanking region, indicating that the expression of OsMT-II-1a might not be appreciably induced by metal ions, which is different from class I MT-like genes. On the basis of the above results, it would appear that the involvement of OsMT-II-1a protein in a general process of metal detoxification or tolerance in developing seeds and 2-day glumes after pollination cannot be attributed, unlike Arabidopsis metallothioneins with the function of metal detoxification, since it is more probable that this kind of mechanism would be accomplished in other parts of rice (e.g. in the leaves or roots) treated with metal ions.
 
In this study, we described and characterized a rice class II MT-like gene OsMT-II-1a; its putative regulatory elements may be present to support its roles in transcriptional regulation processing. Northern blot analysis clearly showed that accumulation of OsMT-II-1a mRNA may occur at specific stages of development (e.g. pollination), in specific tissues (e.g. developing seeds) and under treatments with embryogenesis-related signal molecules (e.g. ABA and H2O2, etc.). These results suggest that the processes of pollination and seed development might be mediated, at least in part, by the expression of the OsMT-II-1a gene that is regulated by ABA and H2O2, etc. Therefore, our results here will provide a framework for continued studies on the transduction pathway linking the environmental signals known to affect pollen embryogenesis, the gene regulated by these signals, and the developmental response of pollination and seed development. It is expected that this work will shed some light on the comprehension of the physiological role of class II MT in plants.
 
[[File:function-1.jpg]]
 
  
 
===Expression===
 
===Expression===
Reynolds and Crawford further showed that ABA biosynthesis is accompanied by increased expression of the EcMT gene transcript concommitant with the differentiation of pollen embryoids in wheat anther cultures, and suggested that the EcMT gene plays an important role in pollen embryogenesis.  
+
[[File:Expression-1.jpg|400px|thumb|right|'''Figure 2''' '' Northern blot analysis of OsMT-II-1a expression'']]
The expression of class I MT-like genes has been characterized in many kinds of tissues. These reports suggest that class I MT-like genes are different in structure and are likely to play diverse roles and functions in plants in order to cope with complex developmental and environmental cues. Our results here show that the transcripts of OsMT-II-1a were specifically abundant not only in developing seeds but also in glumes, whereas the highest expression was detected only in 2-day glumes after pollination, in which levels were 2 times higher than in developing seeds. In addition, the hybridization signal was barely detected in roots, old leaves, mature sheaths and old sheaths, but a very weak hybridization signal was detected in glumes before pollination, young leaves, mature leaves, old leaves and young sheaths. These results further support the fact that expression of OsMT-II-1a is only restricted to a particular developmental stage (e.g. pollination) and specific tissue (e.g. developing seeds). Taken together, the special expression pattern of OsMT-II-1a is consistent with the presence of the predicted embryogenesis-related cis-elements in the 50-flanking region of OsMT-II-1a, which suggests that these cis-elements might be involved in the regulation of OsMT-II-1a during pollination and seed development.
+
* Reynolds and Crawford further showed that ABA biosynthesis is accompanied by increased expression of the EcMT gene transcript concommitant with the differentiation of pollen embryoids in wheat anther cultures, and suggested that the EcMT gene plays an important role in pollen embryogenesis. To date, however, it is not known if different class II MT genes have specific functions in different organs, or at different developmental stages besides embryogenesis. Also their response to the different exogenous factors except zinc remain unclear. Therefore, we were very interested in the relationship between expression of plant class II MT genes and various developmental or environmental signals.
[[File:Expression-1.jpg]]
+
* The expression of class I MT-like genes has been characterized in many kinds of tissues. These reports suggest that class I MT-like genes are different in structure and are likely to play diverse roles and functions in plants in order to cope with complex developmental and environmental cues. To date, however, the expression pattern of class II MT genes has only been reported during wheat embryogenesis and in the developing seeds of Arabidopsis. To investigate the expression pattern of the OsMTII-1a gene in different organs and at different developmental stages, a more detailed analysis of OsMT-II-1a mRNA accumulation in mature plants was carried out.
 +
* Total RNA from tissues of roots, stems, rachises, glumes before pollination, 2-day glumes after pollination, developing seeds, young leaves, mature leaves, old leaves, young sheaths, mature sheaths and old sheaths were subjected to Northern blot analysis. Our results here show that the transcripts of OsMT-II-1a were specifically abundant not only in developing seeds but also in glumes, whereas the highest expression was detected only in 2-day glumes after pollination, in which levels were 2 times higher than in developing seeds.
 +
* In addition, the hybridization signal was barely detected in roots, old leaves, mature sheaths and old sheaths, but a very weak hybridization signal was detected in glumes before pollination, young leaves, mature leaves, old leaves and young sheaths. These results further support the fact that expression of OsMT-II-1a is only restricted to a particular developmental stage (e.g. pollination) and specific tissues. Taken together, the special expression pattern of OsMT-II-1a is consistent with the presence of the predicted embryogenesis-related cis-elements in the 50-flanking region of OsMT-II-1a, which suggests that these cis-elements might be involved in the regulation of OsMT-II-1a during pollination and seed development.
  
 
===Evolution===
 
===Evolution===
The coding region of OsMT-II-1a, when translated, is demonstrated to contain 17 cysteine residues arranged into three groups of 6, 6 and 5 cysteines, which are separated by two interdomain regions of 13 and 15 cysteine-free amino acid residues, respectively. The abundance (about 15%) and the distribution of cysteines in OsMT-II-1a were shown to have structural features characteristic of the class II MT-like proteins. An alignment of the deduced OsMT-II-1a protein with all known class II MT-like proteins is shown in Fig. It has high homology with the plant class II MT-like proteins, with the overall sequence similarity varying substantially from 82% to 49%. We discovered that, unlike class I MT-like genes with several members, the members of class II MT-like genes are no more than 2 in a single species, and the arrangement patterns of cysteines are the same in each member. These results imply that this class of proteins might be conserved in structure and may play a special role in plants. Compared to those proteins from dicots, class II proteins from monocots lack 8–13 amino acids in the N-terminal domain before the first cysteine residue, but have a few additional amino acids in the C-terminal domain, thus maintaining the similar size of class II proteins between monocots and dicots. A phylogenetic tree of all known plant class II MT-like proteins was constructed, which showed two distinct groups corresponding to monocots and dicots. Thus, the differences in the structures of class II MT-like proteins may suggest specific functions for monocots and dicots.
+
* The coding region of OsMT-II-1a, when translated, is demonstrated to contain 17 cysteine residues arranged into three groups of 6, 6 and 5 cysteines, which are separated by two interdomain regions of 13 and 15 cysteine-free amino acid residues, respectively. The abundance (about 15%) and the distribution of cysteines in OsMT-II-1a were shown to have structural features characteristic of the class II MT-like proteins. An alignment of the deduced OsMT-II-1a protein with all known class II MT-like proteins is shown in Fig. It has high homology with the plant class II MT-like proteins, with the overall sequence similarity varying substantially from 82% to 49%.
Several DNA motifs were identified in the promoter of OsMT-II-1a that are homologous to various previously reported regulated elements, which might be important in the transcriptional regulation of this gene. These data hint that OsMT-II-1a protein might play some important role during embryogenesis. In addition, one 86-bp length intron divided the coding sequence of OsMT-II- 1a into two fragments with sizes of 59 and 205 bp. The sequences bordering the inton/exon conform to the GT/AG but not AT/AC rule for splice junctions, which is consistent with other MT-like gene sequences in rice.
+
* We discovered that, unlike class I MT-like genes with several members, the members of class II MT-like genes are no more than 2 in a single species, and the arrangement patterns of cysteines are the same in each member. These results imply that this class of proteins might be conserved in structure and may play a special role in plants. Compared to those proteins from dicots, class II proteins from monocots lack 8–13 amino acids in the N-terminal domain before the first cysteine residue, but have a few additional amino acids in the C-terminal domain, thus maintaining the similar size of class II proteins between monocots and dicots. A phylogenetic tree of all known plant class II MT-like proteins was constructed, which showed two distinct groups corresponding to monocots and dicots. Thus, the differences in the structures of class II MT-like proteins may suggest specific functions for monocots and dicots.
 +
* Several DNA motifs were identified in the promoter of OsMT-II-1a that are homologous to various previously reported regulated elements, which might be important in the transcriptional regulation of this gene. Two putative ABA responsive elements (ABARE) were found (one in a forward orientation and the other in reverse), which were also found in the wheat Em gene and rice rab21 gene.
 +
* One putative ethylene-responsive element identified was the GCC box, GCCGCC, which was found in many ethylene inducible pathogenesis-related genes. An antioxidant response element (ARE), four low-temperature responsive elements (LTRE), four ABARE-like sequences and four CCAAT boxes were also found in the promoter of OsMT-II-1a. In a word, the presence of these homologous sequences may be related with the effects of various stress treatments on the expression of OsMT-II-1a. Also, unlike animal and most plant class I MT genes containing the metal-responsive element TGCRCNC (in which N is not A, and R is A or G) and/or copper-responsive element CTGCCA, the promoter of OsMT-II-1a did not contain any known metal-responsive elements or metal regulatory motifs.
 +
* These findings suggested that the expression of OsMT-II-1a gene might not be modulated by metal ions. Additionally, we also found many cis-elements related with embryo-, pollen- and endosperm-specific gene transcription such as legumin box, ACGT motif, AGAAA motif and (CA)n element. These data hint that OsMT-II-1a protein might play some important role during embryogenesis. In addition, one 86-bp length intron divided the coding sequence of OsMT-II- 1a into two fragments with sizes of 59 and 205 bp. The sequences bordering the inton/exon conform to the GT/AG but not AT/AC rule for splice junctions, which is consistent with other MT-like gene sequences in rice (personal communication).
 
[[File:evolution-1.jpg]]
 
[[File:evolution-1.jpg]]
 +
[[File:evolution-2.jpg]]
 +
[[File:table.jpg]]
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Laboratory of Molecular Biology and MOE Laboratory of Protein Science;
+
* Laboratory of Molecular Biology and MOE Laboratory of Protein Science; Department of Biological Sciences and Biotechnology, Tsinghua University
Department of Biological Sciences and Biotechnology, Tsinghua University
+
 
 +
== References ==
 +
<references>
 +
<ref name="ref1">
 +
Zhou, Gong-Ke, Yu-Feng Xu, and Jin-Yuan Liu. "Characterization of a rice class II metallothionein gene: tissue expression patterns and induction in response to abiotic factors." Journal of plant physiology 162.6 (2005): 686-696.</references>
  
==References==
 
Gong-Ke Zhou;Yu-Feng Xu;Jin-Yuan Liu. Characterization of a rice class II metallothionein gene: Tissue expression patterns and induction in response to abiotic factors. Journal of Plant Physiology, 2005, 162(6): 686-696.
 
Adams T, Saydam N, Steiner F, Schaffner W, Freedman J. Activation of gene expression by metal-responsive signal transduction pathways. Environ Health Perspect 2002;110:813–7.
 
Akashi K, Nishimura N, Ishida Y, Yokota A. Potent hydroxyl
 
radical-scavenging activity of drought-induced type-2
 
metallothionein in wild watermelon. Biochem Biophys
 
Res Commun 2004;323:72–8.
 
Bate N, Twell D. Functional architecture of a late pollen
 
promoter: pollen-specific transcription is developmentally
 
regulated by multiple stage-specific and codependent
 
activator elements. Plant Mol Biol 1998;
 
37:859–69.
 
Breusegem FV, Vranova E, Dat JF, Inze D. The role of
 
active oxygen species in plant signal transduction.
 
Plant Sci 2001;161:405–14.
 
Busk PK, Pages M. Regulation of abscisic acid-induced
 
transcription. Plant Mol Biol 1998;37:425–35.
 
Chatthai M, Kaukinen KH, Tranbarger TJ, Gupta PK, Misra
 
S. The isolation of a novel metallothionein-related
 
cDNA expressed in somatic and zygotic embryos of
 
Douglas-fir: regulation by ABA, osmoticum, and metal
 
ions. Plant Mol Biol 1997;34:243–54.
 
Cobbett CS. Phytochelatins and their roles in heavy metal
 
detoxification. Plant Physiol 2000;123:825–32.
 
Cobbett CS, Goldsbrough PB. Phytochelatins and metallothioneins:
 
roles in heavy metal detoxification and
 
homeostasis. Annu Rev Plant Biol 2002;53:159–82.
 
Coyle P, Philcox JC, Carey LC, Rofe AM. Metallothionein:
 
the multipurpose protein. Cell Mol Life Sci 2002;59:
 
627–47.
 
Ellerstrom M, Stalberg K, Ezcurra I, Rask L. Functional
 
dissection of a napin gene promoter: identification
 
of promoter elements required for embryo andendosperm-specific transcription. Plant Mol Biol
 
1996;32:1019–27.
 
Fujiwara T, Beachy RN. Tissue-specific and temporal
 
regulation of a beta-conglycinin gene: roles of the RY
 
repeat and other cis-acting elements. Plant Mol Biol
 
1994;24:261–72.
 
Garcia-Hernandez M, Murphy A, Taiz L. Metallothioneins 1
 
and 2 have distinct but overlapping expression patterns
 
in Arabidopsis. Plant Physiol 1998;118:387–97.
 
Ghoshal K, Jacob ST. Regulation of metallothionein gene
 
expression. Prog Nucl Acid Res Mol Biol 2001;66:
 
357–84.
 
Giritch A, Ganal M, Stephan UW, Baumlein H. Structure,
 
expression and chromosomal localisation of the
 
metallothionein-like gene family of tomato. Plant
 
Mol Biol 1998;37:701–14.
 
Robinson NJ, Tommey AM, Kuske C, Jackson PJ. Plant
 
metallothioneins. Biochem J 1993;295:1–10.
 
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE,
 
Bleecker AB. A copper cofactor for the ethylene
 
recptor ETR1 from Arabidopsis. Science 1999;283:
 
996–8.
 
Rushmore TH, Morton MR, Pickett CB. The antioxidant
 
responsive element. Activation by oxidative stress and
 
identification of the DNA consensus sequence required
 
for functional activity. J Biol Chem 1991;266:11,632–9.
 
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A
 
Laboratory Manual, second edition. New York: Cold
 
Spring Harbor Laboratory Press; 1989.
 
Sato M, Kondoh M. Recent studies on metallothionein:
 
protection against toxicity of heavy metals and oxygen
 
free radicals. Tohoku J Exp Med 2002;196:9–22.
 
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
 
GeneName = Os10g0542100|
 
Description = Plant EC metallothionein-like protein, family 15 protein|
 
Version = NM_001071727.1 GI:115483197 GeneID:4349263|
 
Length = 737 bp|
 
Definition = Oryza sativa Japonica Group Os10g0542100, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 10|Chromosome 10]]|
 
AP = Chromosome 10:21623772..21624508|
 
CDS = 21623825..21623883,21623970..21624174|
 
GCID = <gbrowseImage1>
 
name=NC_008403:21623772..21624508
 
source=RiceChromosome10
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008403:21623772..21624508
 
source=RiceChromosome10
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctga</cdnaseq>|
 
AA = <aaseq>MGCDDKCGCAVPCPGGTGCRCASSARSGGGDHTTCSCGDHCGCN                    PCRCGRESQPTGRENRRAGCSCGDSCTCASCGSTTTTAPAATT</aaseq>|
 
DNA = <dnaseqindica>54..112#199..403#actgtacagggtagtagatctttcgtacgttggagccggccggatcgacgaccatggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtacggcgatctggtcgcccttggcatcttggcgaccgtgaaaccaactgaacaattcaagtgtatgtccacgcgtgtgggtgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctgatccatccatccatgcgcccaaaaatgcccaacgagacgtgtttatacgtgtggttaagcgtgtgtacgtgcgccatgcttagtactcatagctgcttagctaaacagcacagctgataaataaaaagggcttgctgcttgagtcgagtcgtatcccgttgtctagttctggctagactcgcgcatcacgcatgcaacggacatggtgatacgcgagggatggagagttcggagttgggagacactgtgtactgcagtaccaggttgataagtgtgtctgtacttgtgtaaatatgttttacatgaataaaaaggttggtaactttgtcatgttt</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001071727.1 RefSeq:Os10g0542100]|
 
}}
 
 
[[Category:Genes]]
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Japonica mRNA]]

Latest revision as of 10:29, 24 June 2016

The rice Os10g0542100 was first identified as OsMT-II-1a in 2005 by the researchers from Tsinghua University [1].

Background

  • Metallothioneins (MTs) are defined as a class of evolutionally conserved, low molecular-weight, cysteine-rich, metal-binding proteins. Since MTs were firstly purified from horse kidney as Cd-binding proteins in 1956, they have been widely found in diverse organisms including fungi, plants, mammals and cyanobacteria. Unlike in animals, only EcMT from wheat germ and MT1, MT2 and MT3 from Arabidopsis have been purified in plants. In most cases, however, the presence of proteins has been largely inferred from DNA sequence, so the term MT-like proteins is preferred for plant MTs. Plant MT-like proteins are divided into three major classes (class I, II and III), which are distinguishable on the basis of the distribution of cysteine residues in their sequence. Class I MTs are monomers with two cysteine-rich clusters separated by a central cysteine free spacer.
  • Most of the deduced products of MT genes identified in both monocots and dicots belong to class I. Based on the arrangement of cysteine residues, plant class I MT proteins have been subdivided into several types.Class II MTs are translational monomers in which cysteine residues are scattered throughout the entire sequence, lacking the internal spacer. This class of protein is exemplified by the wheat EcMT(formerly cysteine-labeled metallothionein) protein, the first characterized plant MT protein. Class III MTs are non-translationally synthesized polypeptides based on repeating units of g-glutamlcysteine (g-Glu-Cys), and are broadly found in the plant kingdom including algae and certain fungi.
  • On the other hand, Cobbett and Goldsbrough (2002) proposed a classification system which was able to place the known plant MT proteins into four types based on amino acid sequence. Based on their nomenclature, the class II MT-like protein (OsMT-II) described in this paper may be classified as type 4 MT. Recently, the number of plant MT genes discovered has increased dramatically, and many have not been included in these four types. Because the former nomenclature of three classes can accommodate for an increasing number of plant MTs to be subdivided into different types, we tend to regard the OsMT-like protein described in this paper asclass II MT.

Annotated Information

Function

  • This genomic fragment encoding a characteristic metallothionein (MT) protein, and its full-length cDNA was isolated from rice developing seeds by RT-PCR. This cDNA, designated OsMT-II-1a, contains an open reading frame of 264 bp encoding a protein of 87 amino acid residues. The predicted amino acid sequence was shown to have structural features characteristic of plant class II MT proteins. Accumulation of OsMT-II-1a mRNA is specifically abundant in developing seeds and 2-day glumes after pollination, and OsMT-II-1a transcription can markedly be induced by H2O2, paraquat, SNP, ethephon, ABA and SA, but barely by metal ions or other exogenous abiotic factors such as low temperature and PEG. The processes of pollination and seed development might be mediated, at least in part, by expression of the OsMT-II-1a gene that is regulated by several abiotic factors.
Figure 1 Northern blot analysis of OsMT-II-1a under different metal ion treatments.
  • Recently, several studies indicated that plant MT-like proteins, especially the characterized plant class II MT-like proteins, are also involved in important developmental processes showed that the 50-flanking genomic DNA for the wheat EcMT gene contains a core sequence in the 50-flanking region known to be an ABA-responsive element (ABARE), but does not contain metal-responsive elements seen in animal MT genes. Consistent with this, accumulation of the EcMT mRNA is strongly induced during development of immature embryos but not during germination of mature wheat embryos unless ABA is added to the germination medium. Also, supplementation of the medium with zinc does not induce accumulation of EcMT mRNA in germination embryos.
  • Accumulation of OsMT-II-1a mRNA is specifically abundant in developing seeds and 2-day glumes after pollination. However, embryogenesis is a complex process regulated by the developmental program and aimed at the formation of viable seeds able to germinate under appropriate environmental conditions. ABA and active oxygen species are postulated to play an important role in many processes of embryogenesis. Also, a hallmark of MT gene regulation is their inducibility by different endogenous and exogenous factors acting directly or indirectly on multiple cis-acting motifs in the regulatory regions of MT genes.
  • On the basis of the above results and previous studies, we further propose that the OsMT-II-1a protein not only shares similar roles with wheat EcMT protein in storing metal ions that are required during germination, but might also be involved in providing metal ions to maturing pollen grains since some metals, such as Cu, Zn and Fe, are essential micronutrient elements required for a variety of processes in cellular metabolism and serve as structural and catalytic components of proteins and enzymes. The latter proposal is further supported by results showing that the transcript abundance of OsMT-II-1a can be detected by treatment with ethephon, but it is barely detectable in the rachises, stems, sheaths, leaves and roots.
  • It should be noted that ethylene can also modulate the expression of OsMT-II-1a. What is the relationship between metal ions, OsMT-II-1a expression and ethylene during embryogenesis? Results from recent studies indicated that metal ions are involved in ethylene perception and signal transduction by binding to the receptor. In our opinion, it is possible that application of exogenous ethephon may result in an increased usage of metal ions, thereby lowering the cellular metal ion pool.
  • This in turn increases OsMT-II-1a expression and enhances the transport of metal ions that is required during germination and maturation of pollen grains. On the other hand, ethylene can enhance the production of active oxygen species, which in turn can induce the OsMT-II-1a gene expression. Whether ethylene modulates the expression of OsMT-II-1a alone or in conjunction with other signaling molecules such as active oxygen species remains to be further investigated. Furthermore, a variety of oxidants such as H2O2, SNP and paraquat are involved in the regulation of MT gene expression by inducing disulfide formation. Comparison with the presence of putative ARE in the 50-flanking region raises the question of whether oxidants induce the expression of OsMT-II-1a by oxidizing MT cysteines, by ARE, or by both of them together. Further analysis is required to evaluate the relationship between oxidants and OsMT-II-1a expression. Additionally, SA treatments can markedly enhance H2O2 production, which suggests that SA-mediated H2O2 production may result in OsMT-II-1a expression. Previous studies indicated that accumulation of EcMT mRNA can be induced strongly by ABA. Our results presented here are in line with their findings, showing that in both roots and shoots, the transcription of OsMT-II-1a gene is markedly induced by ABA.

Expression

Figure 2 Northern blot analysis of OsMT-II-1a expression
  • Reynolds and Crawford further showed that ABA biosynthesis is accompanied by increased expression of the EcMT gene transcript concommitant with the differentiation of pollen embryoids in wheat anther cultures, and suggested that the EcMT gene plays an important role in pollen embryogenesis. To date, however, it is not known if different class II MT genes have specific functions in different organs, or at different developmental stages besides embryogenesis. Also their response to the different exogenous factors except zinc remain unclear. Therefore, we were very interested in the relationship between expression of plant class II MT genes and various developmental or environmental signals.
  • The expression of class I MT-like genes has been characterized in many kinds of tissues. These reports suggest that class I MT-like genes are different in structure and are likely to play diverse roles and functions in plants in order to cope with complex developmental and environmental cues. To date, however, the expression pattern of class II MT genes has only been reported during wheat embryogenesis and in the developing seeds of Arabidopsis. To investigate the expression pattern of the OsMTII-1a gene in different organs and at different developmental stages, a more detailed analysis of OsMT-II-1a mRNA accumulation in mature plants was carried out.
  • Total RNA from tissues of roots, stems, rachises, glumes before pollination, 2-day glumes after pollination, developing seeds, young leaves, mature leaves, old leaves, young sheaths, mature sheaths and old sheaths were subjected to Northern blot analysis. Our results here show that the transcripts of OsMT-II-1a were specifically abundant not only in developing seeds but also in glumes, whereas the highest expression was detected only in 2-day glumes after pollination, in which levels were 2 times higher than in developing seeds.
  • In addition, the hybridization signal was barely detected in roots, old leaves, mature sheaths and old sheaths, but a very weak hybridization signal was detected in glumes before pollination, young leaves, mature leaves, old leaves and young sheaths. These results further support the fact that expression of OsMT-II-1a is only restricted to a particular developmental stage (e.g. pollination) and specific tissues. Taken together, the special expression pattern of OsMT-II-1a is consistent with the presence of the predicted embryogenesis-related cis-elements in the 50-flanking region of OsMT-II-1a, which suggests that these cis-elements might be involved in the regulation of OsMT-II-1a during pollination and seed development.

Evolution

  • The coding region of OsMT-II-1a, when translated, is demonstrated to contain 17 cysteine residues arranged into three groups of 6, 6 and 5 cysteines, which are separated by two interdomain regions of 13 and 15 cysteine-free amino acid residues, respectively. The abundance (about 15%) and the distribution of cysteines in OsMT-II-1a were shown to have structural features characteristic of the class II MT-like proteins. An alignment of the deduced OsMT-II-1a protein with all known class II MT-like proteins is shown in Fig. It has high homology with the plant class II MT-like proteins, with the overall sequence similarity varying substantially from 82% to 49%.
  • We discovered that, unlike class I MT-like genes with several members, the members of class II MT-like genes are no more than 2 in a single species, and the arrangement patterns of cysteines are the same in each member. These results imply that this class of proteins might be conserved in structure and may play a special role in plants. Compared to those proteins from dicots, class II proteins from monocots lack 8–13 amino acids in the N-terminal domain before the first cysteine residue, but have a few additional amino acids in the C-terminal domain, thus maintaining the similar size of class II proteins between monocots and dicots. A phylogenetic tree of all known plant class II MT-like proteins was constructed, which showed two distinct groups corresponding to monocots and dicots. Thus, the differences in the structures of class II MT-like proteins may suggest specific functions for monocots and dicots.
  • Several DNA motifs were identified in the promoter of OsMT-II-1a that are homologous to various previously reported regulated elements, which might be important in the transcriptional regulation of this gene. Two putative ABA responsive elements (ABARE) were found (one in a forward orientation and the other in reverse), which were also found in the wheat Em gene and rice rab21 gene.
  • One putative ethylene-responsive element identified was the GCC box, GCCGCC, which was found in many ethylene inducible pathogenesis-related genes. An antioxidant response element (ARE), four low-temperature responsive elements (LTRE), four ABARE-like sequences and four CCAAT boxes were also found in the promoter of OsMT-II-1a. In a word, the presence of these homologous sequences may be related with the effects of various stress treatments on the expression of OsMT-II-1a. Also, unlike animal and most plant class I MT genes containing the metal-responsive element TGCRCNC (in which N is not A, and R is A or G) and/or copper-responsive element CTGCCA, the promoter of OsMT-II-1a did not contain any known metal-responsive elements or metal regulatory motifs.
  • These findings suggested that the expression of OsMT-II-1a gene might not be modulated by metal ions. Additionally, we also found many cis-elements related with embryo-, pollen- and endosperm-specific gene transcription such as legumin box, ACGT motif, AGAAA motif and (CA)n element. These data hint that OsMT-II-1a protein might play some important role during embryogenesis. In addition, one 86-bp length intron divided the coding sequence of OsMT-II- 1a into two fragments with sizes of 59 and 205 bp. The sequences bordering the inton/exon conform to the GT/AG but not AT/AC rule for splice junctions, which is consistent with other MT-like gene sequences in rice (personal communication).

Evolution-1.jpg Evolution-2.jpg Table.jpg

Labs working on this gene

  • Laboratory of Molecular Biology and MOE Laboratory of Protein Science; Department of Biological Sciences and Biotechnology, Tsinghua University

References

  1. Cite error: Invalid <ref> tag; no text was provided for refs named ref1


Structured Information