Difference between revisions of "Os01g0580500"

From RiceWiki
Jump to: navigation, search
 
(11 intermediate revisions by 2 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
*ACO and/or ACS knockdown IL7 rice lines to reveal that HRassociated cyanide/ethylene biosynthesis is required for the resistance to blast fungus..
  
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Please input function information here.
+
*ACO and/or ACS knockdown IL7 rice lines to reveal that HRassociated cyanide/ethylene biosynthesis is required for the resistance to blast fungus.
 +
*The HR-inducible rice ACS and ACO genes, OsACS2, OsACO5, and OsACO7 (Iwai et al., 2006), were silenced in IL7 line using inverted repeat (IR) constructs that included portions of the corresponding cDNAs (Fig. 1A).
 +
[[File:17-f1.png |center |thumb |10000px |''''''Figure 1. Generation of ACO- and ACS/ACO-silenced plants. A, Structure of the OsACS2, OsACO5, and OsACO7 genes and schematic representation of the constructs used to transform rice plants. Boxes below individual cDNAs indicate the regions used for construction. B, Emission of ethylene from leaves after wounding.
 +
Leaves were cut into small pieces and incubated in a sealed vial at 25�C for 24 h under continuous light. A transgenic IL7 line transformed with the vector alone was used as a control (Cont.).C, Reverse transcription-PCR analysis of rice ACS and ACO genes in leaves at 24 h after wounding. OsActin3, which is constitutively expressed in leaves,was used as an internal control. D,Quantitative real-time PCR analysis of the OsACO1 gene in leaves at 48 hpi.Values are means 6 SE (n = 12).'''''']]
 +
<br>
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
*Compared with control plants, which include wild-type IL7 and transgenic IL7 lines expressing only an empty vector, ethylene emissions via blast infection during this period were reduced (Fig. 2A) as well as the transcript levels of OsACO5, OsACO7, and OsACS2 (Fig. 2, B and C) in the IRACO10, IRACO101, and IRACS/ACO13 lines.
 
+
[[File:17-f2.png |center |thumb |10000px |''''''Figure 2. Breakdown of Pi-i-originated blast resistance in ACO/ACS knockdown rice plants. A,Ethylene emission from leaves. Ethylene concentrations emitted from leaves at 36 to 60 hpi were
===Evolution===
+
normalized with the amount of fungal DNA extracted from the inoculated leaves at 60 hpi.B and C, Relative transcript levels of OsACO5 (B),OsACO7 (B), and OsACS2 (C) genes in leaves at 48 hpi, which were normalized with fungal DNA levels. For A to C, the values are means 6 SE(n = 12). D, Distinct lesion types were apparent in leaves at 8 dpi. Numbers of ELs with an area
Please input evolution information here.
+
greater than 0.5 mm2 per leaf and their mean areas were determined using 11 leaves for wild-type(WT) Nipponbare, 30 leaves for wild-type IL7, 12 leaves for IRACO10, 19 leaves for IRACO101, and three leaves for IRACS/ACO13. Values given are means 6 SE. One leaf per plant was used. White arrowheads indicate typical ELs in whitish brown.E, Phenotypes of ACO-silenced and control IL7 plants grown in a greenhouse. Left, 50 dpi; right, 70 dpi. For A to E, similar results to wild-type IL7 were obtained by transgenic IL7 plants transformed with the vector alone.'''''']]
 
+
<br>
You can also add sub-section(s) at will.
 
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
*Plant-Microbe Interactions Research Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305–8602, Japan (S.S., I.M., J.F., Y.O.);
 +
*Miyagi University, Sendai, Miyagi 982–0215, Japan (T.I.);
 +
*College of Agriculture, Ibaraki University, 3–21–1 Chuo, Ami, Ibaraki 300–0393, Japan (M.H.)
 +
<br>
  
 
==References==
 
==References==
Please input cited references here.
+
*'''Bleecker AB, Kende H'''(2000) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16: 1–18
 +
<br>
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]]
GeneName = Os01g0580500|
 
Description = Similar to 1-aminocyclopropane-1-carboxylate oxidase (Fragment)|
 
Version = NM_001049943.1 GI:115437899 GeneID:4324194|
 
Length = 1472 bp|
 
Definition = Oryza sativa Japonica Group Os01g0580500, complete gene.|
 
Source = Oryza sativa Japonica Group
 
 
 
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
 
AP = Chromosome 1:24146341..24147812|
 
CDS = 24146463..24146570,24146860..24147690|
 
GCID = <gbrowseImage1>
 
name=NC_008394:24146341..24147812
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008394:24146341..24147812
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggagattccagtgattgatctcaaggggctcgccggcggcgacgaagaaagggagcgcaccatggcccagctccacgaggcctgtaaggactggggcttcttctgggtggaaaaccatggcgtggaggcggcgttaatggaggaggtgaagagcttcgtgtaccgccattacgacgagcacctggagaagaaattctacgcctccgacctcgccaagaacctccacctgaacaaggacgacggcgacgtcctcgtcgacggcggcgacctcgccgaccaggccgactgggaggccacctacttcatccagcaccgccccaagaacaccgccgccgacttcccggacatcccgccggcggcgagggagtccctggacgcgtacatcgcgcaggcggtgtccctcgccgagctgctcgccggctgcatcagcaccaacctgggcctcgccggcgccgccggcgtcgtggacgccttcgcgccgccgttcgtcggcaccaagttcgccatgtacccaccgtgcccgcgcccggacctcgtctggggcctccgcgcccacaccgacgccggcggcatcatcctgctcctccaggacgacgccgtcggcgggctcgagttccaccgcggcggccgcgagtgggtccccgtcggcccgacccggcgcggccggctgttcgtcaacatcggcgaccaggtggaggtgctcagcggcggcgcctacaagagcgtcgtgcaccgcgtcgccgccggcgccgagggccgccgcctgtccgtcgccacgttctacaaccccgggcccgacgccgtgatcgcgccggcgacggcggcggcgccgtaccccgggccgtacaggtacggcgactacctggactactaccagggcaccaagttcggcgacaagaccgctaggttccaggccgtcaagaagctcttcagctga</cdnaseq>|
 
AA = <aaseq>MEIPVIDLKGLAGGDEERERTMAQLHEACKDWGFFWVENHGVEA                    ALMEEVKSFVYRHYDEHLEKKFYASDLAKNLHLNKDDGDVLVDGGDLADQADWEATYF                    IQHRPKNTAADFPDIPPAARESLDAYIAQAVSLAELLAGCISTNLGLAGAAGVVDAFA                    PPFVGTKFAMYPPCPRPDLVWGLRAHTDAGGIILLLQDDAVGGLEFHRGGREWVPVGP                    TRRGRLFVNIGDQVEVLSGGAYKSVVHRVAAGAEGRRLSVATFYNPGPDAVIAPATAA                    APYPGPYRYGDYLDYYQGTKFGDKTARFQAVKKLFS</aaseq>|
 
DNA = <dnaseqindica>123..230#520..1350#actcgctcatcggaagcaaatcatcttcctagtgcatacaagttagctcatcatcagcactagtacagtactactagacagttgtacgtacaagtagaagtagctacccaaccttgggagagatggagattccagtgattgatctcaaggggctcgccggcggcgacgaagaaagggagcgcaccatggcccagctccacgaggcctgtaaggactggggcttcttctgggtacgtgacaacacttcagagattatttgagagtggaacagttttgagcaccactgtttttttagcaatgcaaaatcgaacaggtctaaatgtaacatgttagcaaagtacttgaaattataaatgtagtagtacaactttgatgctaaataattagattatattttttttaaaaaaaactgttggtcagattttgattcttcaaatgtgaaaactgacaaatgtgtacctctatgttggctgtcgcaaaattaattctgcttcggtgaaatgctcgctacgaatgcaggtggaaaaccatggcgtggaggcggcgttaatggaggaggtgaagagcttcgtgtaccgccattacgacgagcacctggagaagaaattctacgcctccgacctcgccaagaacctccacctgaacaaggacgacggcgacgtcctcgtcgacggcggcgacctcgccgaccaggccgactgggaggccacctacttcatccagcaccgccccaagaacaccgccgccgacttcccggacatcccgccggcggcgagggagtccctggacgcgtacatcgcgcaggcggtgtccctcgccgagctgctcgccggctgcatcagcaccaacctgggcctcgccggcgccgccggcgtcgtggacgccttcgcgccgccgttcgtcggcaccaagttcgccatgtacccaccgtgcccgcgcccggacctcgtctggggcctccgcgcccacaccgacgccggcggcatcatcctgctcctccaggacgacgccgtcggcgggctcgagttccaccgcggcggccgcgagtgggtccccgtcggcccgacccggcgcggccggctgttcgtcaacatcggcgaccaggtggaggtgctcagcggcggcgcctacaagagcgtcgtgcaccgcgtcgccgccggcgccgagggccgccgcctgtccgtcgccacgttctacaaccccgggcccgacgccgtgatcgcgccggcgacggcggcggcgccgtaccccgggccgtacaggtacggcgactacctggactactaccagggcaccaagttcggcgacaagaccgctaggttccaggccgtcaagaagctcttcagctgattaagcacttggggattatattttgttgtgatgtgattaaaatcgcgtgcgctaatcggggtttgtaactttgtatacttgtttggtttgaatcaatcgtcgtgtagtacgcagggttcccc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001049943.1 RefSeq:Os01g0580500]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 1]]
 
[[Category:Chromosome 1]]
 

Latest revision as of 09:38, 19 August 2016

  • ACO and/or ACS knockdown IL7 rice lines to reveal that HRassociated cyanide/ethylene biosynthesis is required for the resistance to blast fungus..

Annotated Information

Function

  • ACO and/or ACS knockdown IL7 rice lines to reveal that HRassociated cyanide/ethylene biosynthesis is required for the resistance to blast fungus.
  • The HR-inducible rice ACS and ACO genes, OsACS2, OsACO5, and OsACO7 (Iwai et al., 2006), were silenced in IL7 line using inverted repeat (IR) constructs that included portions of the corresponding cDNAs (Fig. 1A).
'Figure 1. Generation of ACO- and ACS/ACO-silenced plants. A, Structure of the OsACS2, OsACO5, and OsACO7 genes and schematic representation of the constructs used to transform rice plants. Boxes below individual cDNAs indicate the regions used for construction. B, Emission of ethylene from leaves after wounding. Leaves were cut into small pieces and incubated in a sealed vial at 25�C for 24 h under continuous light. A transgenic IL7 line transformed with the vector alone was used as a control (Cont.).C, Reverse transcription-PCR analysis of rice ACS and ACO genes in leaves at 24 h after wounding. OsActin3, which is constitutively expressed in leaves,was used as an internal control. D,Quantitative real-time PCR analysis of the OsACO1 gene in leaves at 48 hpi.Values are means 6 SE (n = 12).'


Expression

  • Compared with control plants, which include wild-type IL7 and transgenic IL7 lines expressing only an empty vector, ethylene emissions via blast infection during this period were reduced (Fig. 2A) as well as the transcript levels of OsACO5, OsACO7, and OsACS2 (Fig. 2, B and C) in the IRACO10, IRACO101, and IRACS/ACO13 lines.
'Figure 2. Breakdown of Pi-i-originated blast resistance in ACO/ACS knockdown rice plants. A,Ethylene emission from leaves. Ethylene concentrations emitted from leaves at 36 to 60 hpi were normalized with the amount of fungal DNA extracted from the inoculated leaves at 60 hpi.B and C, Relative transcript levels of OsACO5 (B),OsACO7 (B), and OsACS2 (C) genes in leaves at 48 hpi, which were normalized with fungal DNA levels. For A to C, the values are means 6 SE(n = 12). D, Distinct lesion types were apparent in leaves at 8 dpi. Numbers of ELs with an area greater than 0.5 mm2 per leaf and their mean areas were determined using 11 leaves for wild-type(WT) Nipponbare, 30 leaves for wild-type IL7, 12 leaves for IRACO10, 19 leaves for IRACO101, and three leaves for IRACS/ACO13. Values given are means 6 SE. One leaf per plant was used. White arrowheads indicate typical ELs in whitish brown.E, Phenotypes of ACO-silenced and control IL7 plants grown in a greenhouse. Left, 50 dpi; right, 70 dpi. For A to E, similar results to wild-type IL7 were obtained by transgenic IL7 plants transformed with the vector alone.'


Labs working on this gene

  • Plant-Microbe Interactions Research Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305–8602, Japan (S.S., I.M., J.F., Y.O.);
  • Miyagi University, Sendai, Miyagi 982–0215, Japan (T.I.);
  • College of Agriculture, Ibaraki University, 3–21–1 Chuo, Ami, Ibaraki 300–0393, Japan (M.H.)


References

  • Bleecker AB, Kende H(2000) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16: 1–18


Structured Information