Difference between revisions of "Os04g0610800"

From RiceWiki
Jump to: navigation, search
(Annotated Information)
 
(18 intermediate revisions by 2 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice gene  Os04g0610800 was reported as '''''rlin1''''' in 2010 by researchers from China<ref name="ref1" />.
 +
==Annotated Information==
 +
===Gene Symbol===
  
==Annotated Information==
+
*'''''Os04g0610800 <=> CPO, CPOX, LLM1, RLIN1
 
===Function===
 
===Function===
Please input function information here.
+
* '''''RLIN1''''' encoded a putative coproporphyrinogen III oxidase in tetrapyrrole biosynthesis pathway.
 +
 
 +
* '''''RLIN1''''' may be a tetrapyrrole biosynthesis gene is involved in lesion formation in rice.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
===Mutation===
 +
[[File:Os04g0610800-1.png|right|thumb|400px|'''Fig. 2. Phenotypes of mutant rlin1. A: plants of wild-type (light) and rlin1 (right). B: leaf sheath of wild-type (right) and rlin1 (left). C: leaves of wild-type (right) and rlin1 (left). D: panicles of wild-type (right) and rlin1 (left).''' '' <ref name="ref1" />.'']]
 +
 
 +
 
 +
* Two weeks after seeding, the mutant rlin1 had already begun to develop lesions on the young leaves and leaf sheaths shortly after full leaf expansion in both Beijing (N: 39.92_) and Hainan (N: 18.48_). The lesions initiated as small spots or stripes, then spreaded through the main vein of leaves or the middle part of the leaves. At the same time, more severe lesions were formed on the leaf sheaths. In the reproductive growth phase, lesions were also found on the spikes and spermoderms. Besides these, rlin1 showed slightly reduced plant height and later flowering phenotype compared to the wild-type (Fig. 2).
 +
 
 +
 
 +
 
 +
 
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
[[File:Os04g0610800-3.png|right|thumb|200px|'''Fig. 6. Expression patterns of RLIN1 in different organs.''' '' <ref name="ref1" />.'']]
 +
 
 +
* The expressions of RLIN1 were examined in different organs by quantitative real-time RT-PCR, and it showed RLIN1 was expressed in all the organs tested, and the expression level was much higher in roots than in the other organs, suggested RLIN1 had important functions in roots. This was corresponded to the report that the tetrapyrroles such as heme might be present in all organs<ref name="ref2" />. Besides roots, RLIN1 expression levels decreased in the order of leaf sheaths, leaves, culms, with the lowest expression in the panicles, this expression pattern was consistent with the lesion mimic phenotype of rlin1 (Fig. 6).
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
  
 
===Evolution===
 
===Evolution===
Please input evolution information here.
+
[[File:Os04g0610800-2.png|right|thumb|400px|'''Fig. 4. phylogenetic tree analysis using Clustal X and MEGA4.''' '' <ref name="ref1" />.'']]
 +
* Alignment of RLIN1 with its homologs showed that the CPOX proteins were highly conserved in different species, especially in the C-terminal region (Fig. 4B).  
  
 
You can also add sub-section(s) at will.
 
You can also add sub-section(s) at will.
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
* Key Laboratory for Cell Proliferation and Regulation Biology of Ministry of Education, College of Life Science, Beijing Normal University,
 +
Beijing 100875, China
 +
* The State Key Laboratory of Plant Genomics and National Plant Gene Research Center (Beijing), Institute of Genetics and Developmental Biology,
 +
Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China
 +
* Graduate School of the Chinese Academy of Sciences, Yuquan Road, Beijing 100039, China
 +
* Rice Research Institute, Sichuan Agricultural University, Chengdu 611130, China
  
 
==References==
 
==References==
Please input cited references here.
+
<references>
 +
* <ref name="ref1">
 +
Sun C, Liu L, Tang J, Lin A, Zhang F, Fang J, Zhang G, Chu C. RLIN1, encoding  a putative coproporphyrinogen III oxidase, is involved in lesion initiation in rice. J Genet Genomics. 2011 Jan;38(1):29-37. doi: 10.1016/j.jcg.2010.12.001. PubMed PMID: 21338950.
 +
 
 +
</ref>
 +
* <ref name="ref2">
 +
Boese, Q.F., Spano, A.J., Li, J.M., Timko, M.P., 1991. Aminolevulinic acid
 +
dehydratase in pea (Pisum-Sativum L.). J. Biol. Chem. 266, 17060e17066.
 +
</ref>
 +
</references>
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 4]]
GeneName = Os04g0610800|
 
Description = Similar to Coproporphyrinogen III oxidase (Fragment)|
 
Version = NM_001060368.1 GI:115460465 GeneID:4336951|
 
Length = 3364 bp|
 
Definition = Oryza sativa Japonica Group Os04g0610800, complete gene.|
 
Source = Oryza sativa Japonica Group
 
 
 
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 4|Chromosome 4]]|
 
AP = Chromosome 4:31360555..31363918|
 
CDS = 31360556..31360846,31361671..31361746,31362110..31362204,31362346..31362429,31362711..31362798<br>,31363102..31363226,31363304..31363402,31363616..31363690|
 
GCID = <gbrowseImage1>
 
name=NC_008397:31360555..31363918
 
source=RiceChromosome04
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008397:31360555..31363918
 
source=RiceChromosome04
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atgatccgccgcgtgcagggggaggtgtgcgcggcgctggaggaggccgacgggagcggcgcccggttcgtggaggacgtgtggtcgcgccccggcggcggcgggggcatcagccgggtgctccaggacggccgcgtgttcgagaaggccggggtcaacgtctccgtcgtgtacggcgtcatgccccccgacgcgtaccgcgccgccaagggggaggccggcaagaacggcgcggcggcagatggccccaaggctgggcccgtgcccttctttgccgctggcattagctcggttcttcaccccaagaacccatttgctccaacattgcattttaactaccgctattttgagacagatgcaccgaaagatgctcctggtgcaccaaggcaatggtggtttggaggtggtactgatttgactccttcatatatcattgaagaggatgtgaagcatttccattctgttcaaaaacaagcgtgtgataagtttgacccaagtttttacccgagattcaaaaaatggtgtgatgattatttctatattaagcaccgtaatgagcgtcgggggcttggtggaatattttttgatgatcttaatgactatgatcaagaaatgcttctcaactttgctacagaatgtgcggattctgttgttcctgcatacataccaatcattgaacgccggaaggacactccatttactgaggaacacaaggcatggcaacaactgaggagaggtcgctatgtggagttcaaccttgtatatgatcgcggtaccacatttggcctcaagactggggggaggattgagagtattctggtttctcttccactgactgcacgatggcagtatgatcatacacctgaagagggaactgaagaacggaaacttcttgacgcgtgcataaacccaaaggaatggctcgatctctga</cdnaseq>|
 
AA = <aaseq>MIRRVQGEVCAALEEADGSGARFVEDVWSRPGGGGGISRVLQDG                    RVFEKAGVNVSVVYGVMPPDAYRAAKGEAGKNGAAADGPKAGPVPFFAAGISSVLHPK                    NPFAPTLHFNYRYFETDAPKDAPGAPRQWWFGGGTDLTPSYIIEEDVKHFHSVQKQAC                    DKFDPSFYPRFKKWCDDYFYIKHRNERRGLGGIFFDDLNDYDQEMLLNFATECADSVV                    PAYIPIIERRKDTPFTEEHKAWQQLRRGRYVEFNLVYDRGTTFGLKTGGRIESILVSL                    PLTARWQYDHTPEEGTEERKLLDACINPKEWLDL</aaseq>|
 
DNA = <dnaseqindica>2..292#1117..1192#1556..1650#1792..1875#2157..2244#2548..2672#2750..2848#3062..3136#catgatccgccgcgtgcagggggaggtgtgcgcggcgctggaggaggccgacgggagcggcgcccggttcgtggaggacgtgtggtcgcgccccggcggcggcgggggcatcagccgggtgctccaggacggccgcgtgttcgagaaggccggggtcaacgtctccgtcgtgtacggcgtcatgccccccgacgcgtaccgcgccgccaagggggaggccggcaagaacggcgcggcggcagatggccccaaggctgggcccgtgcccttctttgccgctggcattagctcggtaaggcacaattactggttcattttgagtgagaattttaggtgattttgcagttctagtcattgcattgccgtcagagatttggatttcttagcatcaggggtagtacactacactacgattccattcttcagctttgttggcatccgagattccgagtgcaagtgaactgtttaggtggtcagtaaaatttgggagtctttacatcgcagttgtgtgaatgatttggctattgtgggtgtttactgttcacaatgtccatttttaaacttccatgtgctgtttgacaataacaaacagttgttgagaaggaagtgtttgctagattagtgtttgcttttctgtttgaaatgtagtgatgtcattgctatcttattgtgagaacttgaaatgcataactttgaatttggatatgtagttaagcatttgaatgatgaatttagatgagcccgatattctatcgtcttcctgtatattctcataagagactaggaattctcatatatcggaaaattatgtttttaagaaatttggaacatgctgcattttgttagatgcttcagcttcagccatcatttgaagaactgcggtgaccatgtttgccatgcctgtgcaatatttcctactgtctcttgtatcccaagcactggtgactggtccactgtcttgtgctactgtttatgtgctactaattggaccagtagagttataaagagctagatctttagccaaactttgtatttttgttccacgattaaacacactcactcttgtttcaacatatcatacctttccagtaatggaattattccttttatctgcaggttcttcaccccaagaacccatttgctccaacattgcattttaactaccgctattttgagacagatgcaccgaaaggtatttgtgcgaacaatatacactgcataattttagtttcatcaagtgtaggtcaatcttagcaatttttatgattactttctttttccgcctgcagttgatatgttctctgttctatcctctttaaatcttttgtttagatatacatgtgaatgaagctagattttttttttgaaaaaaaaactggatatctgtatgagacatagagcaattctatttacagtaatgagtaaatataaaactcttaacattctcctatatattacgattaatttacatttggttggccatttaaaccacctttattatcaggaactgcgaatctcatcatgcagattattaattcataatgctctactgcagatgctcctggtgcaccaaggcaatggtggtttggaggtggtactgatttgactccttcatatatcattgaagaggatgtgaagcatttccattctgtatgtaacagttcctgcacatttcaaagccatatgtcctagactcctaggatcaagagttttatttccctcacgtagccaaaacactgttatttgctacttcgtatacatggaactcatttaatttttatgccttttcaggttcaaaaacaagcgtgtgataagtttgacccaagtttttacccgagattcaaaaaatggtgtgatgattatttctatattaaggtacattcagtttcttattgcgtgctatagcaattaagaaaggttctttaatctctgcatatgctgcctttatttggacacttcaattctactatttttttacatcattttctttgataatttatcattgatcttgtgccttcatggttttcactgtaaattagtatttctgaagacagttgttaccttgtttgaataattggaactttggatgaagcaaccattttttccctacattttgttccctgtgttgaatattcatggtttgtccttcaatgcagcaccgtaatgagcgtcgggggcttggtggaatattttttgatgatcttaatgactatgatcaagaaatgcttctcaactttgctacaggtaaaagtccttactagaatgaccacacaaacttaattttatgaattagcttgtagagatgtgccggaaccggtctttcataagacagggatttctgtcagtttgtttcaggaattagttcagatagcagggatatatacatgctcttcctcttttagtatctaattgtttgagccttttttcaaacccaagtggcactactatattgatgttggatgacccagtgaacactggttaaaatggacccaatgtttaagttttcgttctctatgttgacaaacagattgttttgtctatctacagaatgtgcggattctgttgttcctgcatacataccaatcattgaacgccggaaggacactccatttactgaggaacacaaggcatggcaacaactgaggagaggtcgctatgtggagttcaaccttgtaagtgatcttagatgaacacagctagagtctcactgcagtatctgtttctgattccagtgttgcttcttgtgaaggtatatgatcgcggtaccacatttggcctcaagactggggggaggattgagagtattctggtttctcttccactgactgcacgatggcagtatgatcatgtaagctaaaatgctcctttgccttgccaattcaataaacatcaaagtatttcatgctttcagctttaaaacaatacaaaatttaatatcaaatagtgagcatatactgttgaatatgatatattctcggcaaagatcatgttacatgacacattttcatcctcggggagtcagtcaggcaggcaggtttcctaatgtgccatttacttgcagacacctgaagagggaactgaagaacggaaacttcttgacgcgtgcataaacccaaaggaatggctcgatctctgaacagcttgatttcgttcgttcgtccaatcgtttgttagctttcctcgcactctgtagccttacgatctccaaacatgtgtagttcttttacttgtagaatcctgaataagtgtatgatgcaatgcgggtgttttgtttcatctgtcgatgctgttgagctttgtaactgtggtatcagtttctctctttttttcgagtgaatgaaatatagccggtgagccttttccc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001060368.1 RefSeq:Os04g0610800]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 4]]
 
[[Category:Chromosome 4]]
 

Latest revision as of 05:07, 9 October 2016

The rice gene Os04g0610800 was reported as rlin1 in 2010 by researchers from China[1].

Annotated Information

Gene Symbol

  • Os04g0610800 <=> CPO, CPOX, LLM1, RLIN1

Function

  • RLIN1 encoded a putative coproporphyrinogen III oxidase in tetrapyrrole biosynthesis pathway.
  • RLIN1 may be a tetrapyrrole biosynthesis gene is involved in lesion formation in rice.



Mutation

Fig. 2. Phenotypes of mutant rlin1. A: plants of wild-type (light) and rlin1 (right). B: leaf sheath of wild-type (right) and rlin1 (left). C: leaves of wild-type (right) and rlin1 (left). D: panicles of wild-type (right) and rlin1 (left). [1].


  • Two weeks after seeding, the mutant rlin1 had already begun to develop lesions on the young leaves and leaf sheaths shortly after full leaf expansion in both Beijing (N: 39.92_) and Hainan (N: 18.48_). The lesions initiated as small spots or stripes, then spreaded through the main vein of leaves or the middle part of the leaves. At the same time, more severe lesions were formed on the leaf sheaths. In the reproductive growth phase, lesions were also found on the spikes and spermoderms. Besides these, rlin1 showed slightly reduced plant height and later flowering phenotype compared to the wild-type (Fig. 2).



Expression

Fig. 6. Expression patterns of RLIN1 in different organs. [1].
  • The expressions of RLIN1 were examined in different organs by quantitative real-time RT-PCR, and it showed RLIN1 was expressed in all the organs tested, and the expression level was much higher in roots than in the other organs, suggested RLIN1 had important functions in roots. This was corresponded to the report that the tetrapyrroles such as heme might be present in all organs[2]. Besides roots, RLIN1 expression levels decreased in the order of leaf sheaths, leaves, culms, with the lowest expression in the panicles, this expression pattern was consistent with the lesion mimic phenotype of rlin1 (Fig. 6).





Evolution

Fig. 4. phylogenetic tree analysis using Clustal X and MEGA4. [1].
  • Alignment of RLIN1 with its homologs showed that the CPOX proteins were highly conserved in different species, especially in the C-terminal region (Fig. 4B).

You can also add sub-section(s) at will.

Labs working on this gene

  • Key Laboratory for Cell Proliferation and Regulation Biology of Ministry of Education, College of Life Science, Beijing Normal University,

Beijing 100875, China

  • The State Key Laboratory of Plant Genomics and National Plant Gene Research Center (Beijing), Institute of Genetics and Developmental Biology,

Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China

  • Graduate School of the Chinese Academy of Sciences, Yuquan Road, Beijing 100039, China
  • Rice Research Institute, Sichuan Agricultural University, Chengdu 611130, China

References

  1. 1.0 1.1 1.2 1.3 Sun C, Liu L, Tang J, Lin A, Zhang F, Fang J, Zhang G, Chu C. RLIN1, encoding a putative coproporphyrinogen III oxidase, is involved in lesion initiation in rice. J Genet Genomics. 2011 Jan;38(1):29-37. doi: 10.1016/j.jcg.2010.12.001. PubMed PMID: 21338950.
  2. Boese, Q.F., Spano, A.J., Li, J.M., Timko, M.P., 1991. Aminolevulinic acid dehydratase in pea (Pisum-Sativum L.). J. Biol. Chem. 266, 17060e17066.

Structured Information