Difference between revisions of "Os09g0369000"

From RiceWiki
Jump to: navigation, search
(Annotated Information)
 
(3 intermediate revisions by 2 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice '''''Os09g0369000''''' was reported as '''''OsDREB6''''' in 2014 <ref name="ref1" /> by researchers from China.  
  
 
==Annotated Information==
 
==Annotated Information==
 +
[[File:103-Os09g0369000.png|right|thumb|327px|'''Figure 6.''' ''Osmotic stress tolerance assays of OsDREB6 transgenic plants.<ref name="ref1" />.'']]
 +
===Gene Symbol===
 +
*'''''Os09g0369000''''' '''''<=>''''' '''''OsDREB6,DREB6'''''
 
===Function===
 
===Function===
Please input function information here.
+
* '''''OsDREB6''''' is an A-6 subgroup member of the DREB subfamily, encoding AP2/EREBP proteins.
 
+
* '''''OsDREB6''''' may participate in the stress response by mediating the expression of specific genes, and may also be involved plant metabolism.
 +
* '''''OsDREB6''''' plays an important role in the response of plants to a wide range of osmotic stresses.
 +
===Phenotypic analysis===
 +
* Overexpression of OsDREB6 increased tolerance to osmotic, high salt, and cold stresses in transgenic rice whereas, '''''OsDREB6''''' double-stranded RNA interference (RNAi) lines were found to be more sensitive to these stresses than wild- type rice.
 +
* Additionally, sugar, proline and catalase levels in '''''OsDREB6''''' RNAi lines were significantly lower than in the corresponding OsDREB6 overexpression lines and control lines after PEG treatment.
 +
* In contrast, malondialdehyde (MDA) levels were significantly higher in RNAi lines than in control and overexpression lines. Furthermore, expression levels of some stress-related genes were altered in the transgenic plants.
 
===Expression===
 
===Expression===
Please input expression information here.
+
* Expression pattern analysis indicated that '''''OsDREB6''''' was induced in response to dehydration, high salinity, and most importantly by cold stress (4°C).
 
 
===Evolution===
 
Please input evolution information here.
 
  
 
You can also add sub-section(s) at will.
 
You can also add sub-section(s) at will.
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
* College of Plant science&Technology, Huazhong Agriculture University, Wuhan 430070, China
 +
* Shanghai Agrobiological Gene Center, Shanghai 201106, China
 +
* State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China
  
 
==References==
 
==References==
Please input cited references here.
+
<references>
 +
* <ref name="ref1">
 +
Gutha LR, Reddy AR. Rice DREB1B promoter shows distinct stress-specific
 +
responses, and the overexpression of cDNA in tobacco confers improved abiotic and
 +
biotic stress tolerance. Plant Mol Biol. 2008 Dec;68(6):533-55. doi:
 +
10.1007/s11103-008-9391-8. Epub 2008 Aug 28. PubMed PMID: 18754079.
 +
</ref>
 +
</references>
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
+
[[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 9]]
GeneName = Os09g0369000|
 
Description = Similar to DRE binding factor 1|
 
Version = NM_001069548.1 GI:115478838 GeneID:4346884|
 
Length = 1407 bp|
 
Definition = Oryza sativa Japonica Group Os09g0369000, complete gene.|
 
Source = Oryza sativa Japonica Group
 
 
 
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 9|Chromosome 9]]|
 
AP = Chromosome 9:12821375..12822781|
 
CDS = 12821675..12822550|
 
GCID = <gbrowseImage1>
 
name=NC_008402:12821375..12822781
 
source=RiceChromosome09
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008402:12821375..12822781
 
source=RiceChromosome09
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggctgcagctatagatctgtcaggggaggagctgatgagagcactcgagccttttatccgagatgcctccggctcgcctccggtttgttcccagtttagtcccacctcgccattctccttcccgcacgcgttcgcgtacggtggcgggctggcccagcagccagagctcagcccggcccagatgcactacatccaggcccgcctccacctccagcggcaggcggcgcaggccggcccgctcggcccgcgcgcgcagccgatgaaggcgtcgtcgtcgtcggcttcggcggcgggggcggcggcgacgccgccgcggccgcagaagctgtaccgcggcgtgcggcagcggcactgggggaagtgggtggcggagatccgcctcccgcggaaccgcacgcggctctggctcggcaccttcgacacagccgaggaggcggcgcttgcctacgaccaggcggcgtaccgcctccgcggcgacgcggcgcggctcaacttccccgacaacgccgcctcccgcggcccgctccacgcctccgtcgacgccaagctccagacgctctgccagaacatcgccgccgccaagaacgccaagaagtcctctgtctccgcctccgccgccgcaacatcctccgcgcccaccagcaactgctcgtcgccgtcctccgacgacgcgtcgtcctgcctggagtccgccgactcgtcgccctccctgtcgccgtcctccgccgccaccacggccgagacgccggcgaccgtgccggagatgcagcagctcgacttcagcgaggcgccgtgggacgaggccgccgccttcgccctcaccaagtacccgtcctacgagatcgactgggactccctcctcgccgccaattaa</cdnaseq>|
 
AA = <aaseq>MAAAIDLSGEELMRALEPFIRDASGSPPVCSQFSPTSPFSFPHA                    FAYGGGLAQQPELSPAQMHYIQARLHLQRQAAQAGPLGPRAQPMKASSSSASAAGAAA                    TPPRPQKLYRGVRQRHWGKWVAEIRLPRNRTRLWLGTFDTAEEAALAYDQAAYRLRGD                    AARLNFPDNAASRGPLHASVDAKLQTLCQNIAAAKNAKKSSVSASAAATSSAPTSNCS                    SPSSDDASSCLESADSSPSLSPSSAATTAETPATVPEMQQLDFSEAPWDEAAAFALTK                    YPSYEIDWDSLLAAN</aaseq>|
 
DNA = <dnaseqindica>301..1176#cttggttaggttgcttgcagagagcgagagacccagggccttttagatccagggctcccagatctgctgtttttctttcatcttctttgtgttctagtgttaggttggtagccaagaggggttctttttccacacctcacttgctagatctaccaccaaaaagccatctgtttttttactgtggctgtcgatttctccctccttcctgcctgttcttgattttggattcggaaccaggcaaatctttgttactactgttttagtatcagaaaaaaaaatcccaaaaaaaagagtgagtagatggctgcagctatagatctgtcaggggaggagctgatgagagcactcgagccttttatccgagatgcctccggctcgcctccggtttgttcccagtttagtcccacctcgccattctccttcccgcacgcgttcgcgtacggtggcgggctggcccagcagccagagctcagcccggcccagatgcactacatccaggcccgcctccacctccagcggcaggcggcgcaggccggcccgctcggcccgcgcgcgcagccgatgaaggcgtcgtcgtcgtcggcttcggcggcgggggcggcggcgacgccgccgcggccgcagaagctgtaccgcggcgtgcggcagcggcactgggggaagtgggtggcggagatccgcctcccgcggaaccgcacgcggctctggctcggcaccttcgacacagccgaggaggcggcgcttgcctacgaccaggcggcgtaccgcctccgcggcgacgcggcgcggctcaacttccccgacaacgccgcctcccgcggcccgctccacgcctccgtcgacgccaagctccagacgctctgccagaacatcgccgccgccaagaacgccaagaagtcctctgtctccgcctccgccgccgcaacatcctccgcgcccaccagcaactgctcgtcgccgtcctccgacgacgcgtcgtcctgcctggagtccgccgactcgtcgccctccctgtcgccgtcctccgccgccaccacggccgagacgccggcgaccgtgccggagatgcagcagctcgacttcagcgaggcgccgtgggacgaggccgccgccttcgccctcaccaagtacccgtcctacgagatcgactgggactccctcctcgccgccaattaacaccaccaccacttcttggctagtactcacgccgtcgttagcctaatcgtcgccgccgccgccgccgtgcagatgggattttagacattctgcaccgcacggacgggcatggattagcagttttatagtccctaatccttttggtttggttcgtttgtgtacgtagatcgatctctctccggacttgtttcctctgtagatgctagggttggttggtgttcttcctcaacc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001069548.1 RefSeq:Os09g0369000]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 9]]
 
[[Category:Chromosome 9]]
 

Latest revision as of 13:24, 17 October 2016

The rice Os09g0369000 was reported as OsDREB6 in 2014 [1] by researchers from China.

Annotated Information

Figure 6. Osmotic stress tolerance assays of OsDREB6 transgenic plants.[1].

Gene Symbol

  • Os09g0369000 <=> OsDREB6,DREB6

Function

  • OsDREB6 is an A-6 subgroup member of the DREB subfamily, encoding AP2/EREBP proteins.
  • OsDREB6 may participate in the stress response by mediating the expression of specific genes, and may also be involved plant metabolism.
  • OsDREB6 plays an important role in the response of plants to a wide range of osmotic stresses.

Phenotypic analysis

  • Overexpression of OsDREB6 increased tolerance to osmotic, high salt, and cold stresses in transgenic rice whereas, OsDREB6 double-stranded RNA interference (RNAi) lines were found to be more sensitive to these stresses than wild- type rice.
  • Additionally, sugar, proline and catalase levels in OsDREB6 RNAi lines were significantly lower than in the corresponding OsDREB6 overexpression lines and control lines after PEG treatment.
  • In contrast, malondialdehyde (MDA) levels were significantly higher in RNAi lines than in control and overexpression lines. Furthermore, expression levels of some stress-related genes were altered in the transgenic plants.

Expression

  • Expression pattern analysis indicated that OsDREB6 was induced in response to dehydration, high salinity, and most importantly by cold stress (4°C).

You can also add sub-section(s) at will.

Labs working on this gene

  • College of Plant science&Technology, Huazhong Agriculture University, Wuhan 430070, China
  • Shanghai Agrobiological Gene Center, Shanghai 201106, China
  • State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China

References

  1. 1.0 1.1 Gutha LR, Reddy AR. Rice DREB1B promoter shows distinct stress-specific responses, and the overexpression of cDNA in tobacco confers improved abiotic and biotic stress tolerance. Plant Mol Biol. 2008 Dec;68(6):533-55. doi: 10.1007/s11103-008-9391-8. Epub 2008 Aug 28. PubMed PMID: 18754079.

Structured Information