Difference between revisions of "Os01g0907600"

From RiceWiki
Jump to: navigation, search
(Created page with "{{JaponicaGene| GeneName = Os01g0907600| Description = Cysteine endopeptidase| Version = NM_001051673.1 GI:115441716 GeneID:4324982| Length = 1377 bp| Definition = Oryza ...")
 
(Annotated Information)
 
(6 intermediate revisions by 3 users not shown)
Line 1: Line 1:
{{JaponicaGene|
+
The rice '''''Os01g0907600''''' was reported as '''''OsSAG12-1''''' in 2013 <ref name="ref1" /> by researchers from India.  
GeneName = Os01g0907600|
 
Description = Cysteine endopeptidase|
 
Version = NM_001051673.1 GI:115441716 GeneID:4324982|
 
Length = 1377 bp|
 
Definition = Oryza sativa Japonica Group Os01g0907600, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
+
==Annotated Information==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
[[File:134-Os01g0907600.png|right|thumb|327px|'''Figure 3.''' ''Phenotypes of OsSAG12-1 RNAi plants.<ref name="ref1" />.'']]
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
===Gene Symbol===
|
+
*'''''Os01g0907600''''' '''''<=>''''' '''''OsSAG12-1,SAG12-1'''''
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
+
===Function===
AP = Chromosome 1:41257307..41258683|
+
* '''''OsSAG12-1''''' is a negative regulator of cell death in rice.
CDS = 41257326..41258441|
+
 
GCID = <gbrowseImage1>
+
===Phenotypic analysis===
name=NC_008394:41257307..41258683
+
* The figure 3A shows differently growing T2 plants obtained from a single T1 plant. All RNAi lines showed reduced overall growth including height compared to the vector transformed plants (figure 3B). Figure 3B shows the average and standard deviation of heights of the T1 progeny plants obtained from 4 independent T0 RNAi lines and vector-transformed plants at 60 days after sowing.
source=RiceChromosome01
+
* Other than those extreme phenotypic plants that died early, most of the remaining plants also showed accelerated senescence phenotype especially in their flag leaves. The flag leaves from RNAi plants showed com- paratively early senescence compared to vector-transformed plants (figure 3C).  
preset=GeneLocation
+
* Flag leaves are the primary source of nutrient mobilization during the grain filling stage of rice and showed faster senescence compared to the other leaves (Biswas and Choudhuri, 1980). Majority of the other leaves also showed a range of early senescence phenotypes.
</gbrowseImage1>|
+
* While the tips of most of the leaves from vector-transformed plants were green after 60 days, the RNAi plants showed varied degree of senescence (figure 3D). This is in contrast to the flag leaves that showed early senescence throughout the leaf blade.
GSID = <gbrowseImage2>
+
 
name=NC_008394:41257307..41258683
+
You can also add sub-section(s) at will.
source=RiceChromosome01
+
 
preset=GeneLocation
+
==Labs working on this gene==
</gbrowseImage2>|
+
* School of life Sciences, Jawaharlal Nehru University, New Delhi 110 067, India
CDNA = <cdnaseq>atggggagggttattagcagctggagggttcttgcggtggtggctgctttgatggccatggcggcggtggagctgtgcgccgcgataccgttcgacgagagggatttggagtccgacgaggcgctgtgggatctgtacgagcggtggcaggagcaccaccacgtgccgcgccaccacggcgagaagcaccgccggttcggcgcgttcaaggacaacgtgaggtacatccacgagcacaacaagcgcggcggccggggctaccgcctccggctcaaccgcttcggcgacatgggcagagaggagttccgcgccacgttcgccgggtcccacgccaacgacctccgccgcgacggcctcgccgcgccgccgctcccggggttcatgtacgagggcgtccgcgacctcccccgcgccgtcgactggcgccgcaagggcgcggtcaccggcgtcaaggaccagggcaagtgcggcagctgctgggcgttctccacggtggtgtccgtggagggcatcaacgcgatccggacggggcggctggtgtcgctgtcggagcaggagctgatcgactgcgacacggcggacaacagcggctgccagggcgggctcatggagaacgcgttcgagtacatcaagcacagcggcggcatcaccaccgagtccgcctacccgtaccgcgccgccaacggaacgtgcgacgccgtccgcgcgcggcgcgcgccgctggtggtgatcgacgggcaccagaacgtgccggccaacagcgaggccgcgctcgccaaggccgtcgccaaccagcccgtctccgtcgccatcgacgccggcgaccagtccttccagttctactccgacggcgtcttcgccggcgactgcggcaccgacctcgaccacggcgtcgcggtggtcggctacggcgagaccaacgacggcacggagtactggatcgtcaagaactcgtggggcacagcctggggcgagggcggctacatccggatgcagcgcgactccggctacgacggcggcctctgcggcatcgccatggaagcctcctaccccgtcaagttctcgccaaatcgtgtcacgccaaggcgcgcccttggcgccaaggaaacccagtga</cdnaseq>|
+
 
AA = <aaseq>MGRVISSWRVLAVVAALMAMAAVELCAAIPFDERDLESDEALWD                    LYERWQEHHHVPRHHGEKHRRFGAFKDNVRYIHEHNKRGGRGYRLRLNRFGDMGREEF                    RATFAGSHANDLRRDGLAAPPLPGFMYEGVRDLPRAVDWRRKGAVTGVKDQGKCGSCW                    AFSTVVSVEGINAIRTGRLVSLSEQELIDCDTADNSGCQGGLMENAFEYIKHSGGITT                    ESAYPYRAANGTCDAVRARRAPLVVIDGHQNVPANSEAALAKAVANQPVSVAIDAGDQ                    SFQFYSDGVFAGDCGTDLDHGVAVVGYGETNDGTEYWIVKNSWGTAWGEGGYIRMQRD                    SGYDGGLCGIAMEASYPVKFSPNRVTPRRALGAKETQ</aaseq>|
+
==References==
DNA = <dnaseqindica>20..1135#tagtggcgatcgatcgatcatggggagggttattagcagctggagggttcttgcggtggtggctgctttgatggccatggcggcggtggagctgtgcgccgcgataccgttcgacgagagggatttggagtccgacgaggcgctgtgggatctgtacgagcggtggcaggagcaccaccacgtgccgcgccaccacggcgagaagcaccgccggttcggcgcgttcaaggacaacgtgaggtacatccacgagcacaacaagcgcggcggccggggctaccgcctccggctcaaccgcttcggcgacatgggcagagaggagttccgcgccacgttcgccgggtcccacgccaacgacctccgccgcgacggcctcgccgcgccgccgctcccggggttcatgtacgagggcgtccgcgacctcccccgcgccgtcgactggcgccgcaagggcgcggtcaccggcgtcaaggaccagggcaagtgcggcagctgctgggcgttctccacggtggtgtccgtggagggcatcaacgcgatccggacggggcggctggtgtcgctgtcggagcaggagctgatcgactgcgacacggcggacaacagcggctgccagggcgggctcatggagaacgcgttcgagtacatcaagcacagcggcggcatcaccaccgagtccgcctacccgtaccgcgccgccaacggaacgtgcgacgccgtccgcgcgcggcgcgcgccgctggtggtgatcgacgggcaccagaacgtgccggccaacagcgaggccgcgctcgccaaggccgtcgccaaccagcccgtctccgtcgccatcgacgccggcgaccagtccttccagttctactccgacggcgtcttcgccggcgactgcggcaccgacctcgaccacggcgtcgcggtggtcggctacggcgagaccaacgacggcacggagtactggatcgtcaagaactcgtggggcacagcctggggcgagggcggctacatccggatgcagcgcgactccggctacgacggcggcctctgcggcatcgccatggaagcctcctaccccgtcaagttctcgccaaatcgtgtcacgccaaggcgcgcccttggcgccaaggaaacccagtgatcgagccggcgccatctccgccgtacacgtgcccgcctacgagcctggatcaacggctctggtcgcgtctcctcctccagcttgcaaaatggtgctattattgttgctgctctttgttaattgccttgtgtttatgtaattcgtgtgaggcgatcagggaaaagaattacctgaaatcgtctaagttactagtgttatttcgtgtgtgctaaataagttttagatgtgaggtgaggtcgatc</dnaseqindica>|
+
<references>
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001051673.1 RefSeq:Os01g0907600]|
+
* <ref name="ref1">
}}
+
Singh S, Giri MK, Singh PK, Siddiqui A, Nandi AK. Down-regulation of OsSAG12-1
[[Category:Genes]]
+
results in enhanced senescence and pathogen-induced cell death in transgenic rice
[[Category:Japonica mRNA]]
+
plants. J Biosci. 2013 Sep;38(3):583-92. PubMed PMID: 23938390.
[[Category:Oryza Sativa Japonica Group]]
+
</ref>
[[Category:Japonica Genes]]
+
</references>.
[[Category:Japonica Chromosome 1]]
+
 
[[Category:Chromosome 1]]
+
==Structured Information==
 +
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]]

Latest revision as of 16:08, 19 October 2016

The rice Os01g0907600 was reported as OsSAG12-1 in 2013 [1] by researchers from India.

Annotated Information

Figure 3. Phenotypes of OsSAG12-1 RNAi plants.[1].

Gene Symbol

  • Os01g0907600 <=> OsSAG12-1,SAG12-1

Function

  • OsSAG12-1 is a negative regulator of cell death in rice.

Phenotypic analysis

  • The figure 3A shows differently growing T2 plants obtained from a single T1 plant. All RNAi lines showed reduced overall growth including height compared to the vector transformed plants (figure 3B). Figure 3B shows the average and standard deviation of heights of the T1 progeny plants obtained from 4 independent T0 RNAi lines and vector-transformed plants at 60 days after sowing.
  • Other than those extreme phenotypic plants that died early, most of the remaining plants also showed accelerated senescence phenotype especially in their flag leaves. The flag leaves from RNAi plants showed com- paratively early senescence compared to vector-transformed plants (figure 3C).
  • Flag leaves are the primary source of nutrient mobilization during the grain filling stage of rice and showed faster senescence compared to the other leaves (Biswas and Choudhuri, 1980). Majority of the other leaves also showed a range of early senescence phenotypes.
  • While the tips of most of the leaves from vector-transformed plants were green after 60 days, the RNAi plants showed varied degree of senescence (figure 3D). This is in contrast to the flag leaves that showed early senescence throughout the leaf blade.

You can also add sub-section(s) at will.

Labs working on this gene

  • School of life Sciences, Jawaharlal Nehru University, New Delhi 110 067, India

References

  1. 1.0 1.1 Singh S, Giri MK, Singh PK, Siddiqui A, Nandi AK. Down-regulation of OsSAG12-1 results in enhanced senescence and pathogen-induced cell death in transgenic rice plants. J Biosci. 2013 Sep;38(3):583-92. PubMed PMID: 23938390.
.

Structured Information