|
|
| (2 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| − | Please input one-sentence summary here.
| + | The rice '''''Os04g0556500''''' was reported as '''''cZOGT3''''' in 2012 <ref name="ref1" /> by researchers from Japan. |
| | | | |
| | ==Annotated Information== | | ==Annotated Information== |
| | + | ===Gene Symbol=== |
| | + | *'''''Os04g0556500''''' '''''<=>''''' '''''cZOGT3,OscZOGT3''''' |
| | ===Function=== | | ===Function=== |
| − | Please input function information here.
| + | * The cZOGTs preferentially catalyzed O-glucosylation of cZ and cZ-riboside rather than tZ and tZ-riboside in vitro. |
| − | | + | * Transgenic rice lines ectopically overexpressing the '''''cZOGT1''''' and '''''cZOGT2''''' genes exhibited short-shoot phenotypes, delay of leaf senescence, and decrease in crown root number, while cZOGT3 overexpressor lines did not show shortened shoots. |
| − | ===Expression===
| |
| − | Please input expression information here.
| |
| − | | |
| − | ===Evolution===
| |
| − | Please input evolution information here.
| |
| | | | |
| | You can also add sub-section(s) at will. | | You can also add sub-section(s) at will. |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| − | Please input related labs here.
| + | * RIKEN Plant Science Center, Tsurumi, Yokohama 230-0045, Japan. |
| | | | |
| | ==References== | | ==References== |
| − | Please input cited references here.
| + | <references> |
| | + | * <ref name="ref1"> |
| | + | Xu Y, Zhang S, Guo H, Wang S, Xu L, Li C, Qian Q, Chen F, Geisler M, Qi Y, |
| | + | Jiang de A. OsABCB14 functions in auxin transport and iron homeostasis in rice |
| | + | (Oryza sativa L.). Plant J. 2014 Jul;79(1):106-17. doi: 10.1111/tpj.12544. Epub |
| | + | 2014 Jun 13. PubMed PMID: 24798203. |
| | + | </ref> |
| | + | </references> |
| | + | |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 4]] |
| − | GeneName = Os04g0565400|
| |
| − | Description = Similar to Cis-zeatin O-glucosyltransferase 1 (EC 2.4.1.215) (cisZOG1)|
| |
| − | Version = NM_001060109.2 GI:297603191 GeneID:4336683|
| |
| − | Length = 1714 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os04g0565400, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 4|Chromosome 4]]|
| |
| − | AP = Chromosome 4:28735073..28736786|
| |
| − | CDS = 28735177..28736571|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008397:28735073..28736786
| |
| − | source=RiceChromosome04
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008397:28735073..28736786
| |
| − | source=RiceChromosome04
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atggcagagaaggggaacccggcgaacaaggtggccatcgtggcggtgccgttcccggcgcagggtcacctcaaccaggtgctgcacctgtcgctccagctcgcgtcgtcgtcgcacgggctcgcggtccactacgctgcgccggcgccgcagctccgccaggcgcgggcgcgcgtgcacggctgggacgacaaggccctcctctccgtccagttccacgacctcggcatctccacgtacgtctctccgcctcccgaccccaccgccgacacgcccttcccctcccacctcatgcccctctgggaggcgtacaccgcggacgcgcgcgccccgctctcggcgctccttgacgagctatccgcttcccaccgtcgggtcgtcgtcgtgtgcgacaccatcaattccttcgctgtcgaggaggcggcgcggctgcccaacggtgaggcgttcccggtgagctgcgtagccgtgtcggccctcgcccttcacatagacaccgggcatcggctcctgcgtgagaacggcctcaatcatgcccccttggaaacctacatgacgcaggagttcctggactacgcgagcgaacgtgcccgagcgtcggaatcgattttgtccggcgccggcatcctcgcgaacgcgagccgagcactcgagggcgatttcatcgacgatttggctgagactctggctgccggcggcaagaagctcttcgcaatcggtccgttgaacccactgctcaacacgggctcgtcggagcagggcaggcggcgacacgagtgccttgactggctcgacaggcagcccccggattctgtgctctacgtgtcgttcggcacgacgtgctctcttcgagttgagcaggtcgcggagctcgcagcgacactgcgcggcagcaagcagcggttcatctgggtcatgcgcgacgccgaccgcggcaacatattcacggacaccggcgagggcgagacccggcacgccaagcttctgtccgagttctccaagcaaaccgaaggcacggggatggtgatcactgggtgggcgccgcagctggagatcctggcgcacggcgccacggcggcgttcatgagccactgcggctggaactcgaccatggagagcatgagccacgggaagccgattctggcgtggcccatgcactccgaccagccgtgggacgcggagctggtgtgcaaatacttcaaggcaggtctcctagtgaggccatgggagaagcacggcgaggttttgccggcggccactatacaggaggtgatcaagaagatgatggcctccgatgaaggattggcggtgcggcagcgcgcgaaggcgctcggtgatgccgtccgttcatcgcgcaatgatctggaggacttcattgctcacatcacaaggtga</cdnaseq>|
| |
| − | AA = <aaseq>MAEKGNPANKVAIVAVPFPAQGHLNQVLHLSLQLASSSHGLAVH YAAPAPQLRQARARVHGWDDKALLSVQFHDLGISTYVSPPPDPTADTPFPSHLMPLWE AYTADARAPLSALLDELSASHRRVVVVCDTINSFAVEEAARLPNGEAFPVSCVAVSAL ALHIDTGHRLLRENGLNHAPLETYMTQEFLDYASERARASESILSGAGILANASRALE GDFIDDLAETLAAGGKKLFAIGPLNPLLNTGSSEQGRRRHECLDWLDRQPPDSVLYVS FGTTCSLRVEQVAELAATLRGSKQRFIWVMRDADRGNIFTDTGEGETRHAKLLSEFSK QTEGTGMVITGWAPQLEILAHGATAAFMSHCGWNSTMESMSHGKPILAWPMHSDQPWD AELVCKYFKAGLLVRPWEKHGEVLPAATIQEVIKKMMASDEGLAVRQRAKALGDAVRS SRNDLEDFIAHITR</aaseq>|
| |
| − | DNA = <dnaseqindica>105..1499#tgggcagcggccaattacgtttcgttagtcgttaaaacagttaacacctttcaggcttcattcagacttcagctcagtcattcaggcattgagaggcacggagaatggcagagaaggggaacccggcgaacaaggtggccatcgtggcggtgccgttcccggcgcagggtcacctcaaccaggtgctgcacctgtcgctccagctcgcgtcgtcgtcgcacgggctcgcggtccactacgctgcgccggcgccgcagctccgccaggcgcgggcgcgcgtgcacggctgggacgacaaggccctcctctccgtccagttccacgacctcggcatctccacgtacgtctctccgcctcccgaccccaccgccgacacgcccttcccctcccacctcatgcccctctgggaggcgtacaccgcggacgcgcgcgccccgctctcggcgctccttgacgagctatccgcttcccaccgtcgggtcgtcgtcgtgtgcgacaccatcaattccttcgctgtcgaggaggcggcgcggctgcccaacggtgaggcgttcccggtgagctgcgtagccgtgtcggccctcgcccttcacatagacaccgggcatcggctcctgcgtgagaacggcctcaatcatgcccccttggaaacctacatgacgcaggagttcctggactacgcgagcgaacgtgcccgagcgtcggaatcgattttgtccggcgccggcatcctcgcgaacgcgagccgagcactcgagggcgatttcatcgacgatttggctgagactctggctgccggcggcaagaagctcttcgcaatcggtccgttgaacccactgctcaacacgggctcgtcggagcagggcaggcggcgacacgagtgccttgactggctcgacaggcagcccccggattctgtgctctacgtgtcgttcggcacgacgtgctctcttcgagttgagcaggtcgcggagctcgcagcgacactgcgcggcagcaagcagcggttcatctgggtcatgcgcgacgccgaccgcggcaacatattcacggacaccggcgagggcgagacccggcacgccaagcttctgtccgagttctccaagcaaaccgaaggcacggggatggtgatcactgggtgggcgccgcagctggagatcctggcgcacggcgccacggcggcgttcatgagccactgcggctggaactcgaccatggagagcatgagccacgggaagccgattctggcgtggcccatgcactccgaccagccgtgggacgcggagctggtgtgcaaatacttcaaggcaggtctcctagtgaggccatgggagaagcacggcgaggttttgccggcggccactatacaggaggtgatcaagaagatgatggcctccgatgaaggattggcggtgcggcagcgcgcgaaggcgctcggtgatgccgtccgttcatcgcgcaatgatctggaggacttcattgctcacatcacaaggtgatcgaagaataaccccgtgtcaaaaaaaaatacagctttaaactttttcagtagtagcagtttgtattgaatttgactatttgagttaagcagggtctagtaaaatagttgactatttgagttaagcagggtctagtaaaatagttttcagtcctacaaatcaagtgactctatggttgaatcaaataaacatatggtggtgtaaacttggggata</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001060109.2 RefSeq:Os04g0565400]|
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]] | |
| − | [[Category:Japonica Chromosome 4]]
| |
| − | [[Category:Chromosome 4]]
| |