Difference between revisions of "Os07g0689600"

From RiceWiki
Jump to: navigation, search
(Created page with "{{JaponicaGene| GeneName = Os07g0689600| Description = Nicotianamine synthase 3 (EC 2.5.1.43) (S-adenosyl-L-methionine:S- adenosyl-L-methionine:S-adenosyl-methionine 3-amino...")
 
 
(5 intermediate revisions by 3 users not shown)
Line 1: Line 1:
{{JaponicaGene|
+
The rice gene Os07g0689600 was reported as '''''OsNAS3''''' in 2009<ref name="ref1" /> by researchers from Korea and Japan.
GeneName = Os07g0689600|
 
Description = Nicotianamine synthase 3 (EC 2.5.1.43) (S-adenosyl-L-methionine:S- adenosyl-L-methionine:S-adenosyl-methionine 3-amino-3- carboxypropyltransferase 3) (OsNAS3)|
 
Version = NM_001067242.1 GI:115474216 GeneID:4344361|
 
Length = 1510 bp|
 
Definition = Oryza sativa Japonica Group Os07g0689600, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
+
==Annotated Information==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
===Gene Symbol===
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
*'''''Os07g0689600 <=> OsNAS3, NAS3
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
 
|
+
===Function===
Chromosome = [[:category:Japonica Chromosome 7|Chromosome 7]]|
+
* Nicotianamine (NA) is synthesized by nicotianamine synthase (NAS). There are 3 OsNAS genes present in rice, '''''OsNAS1''''', '''''OsNAS2''''' and '''''OsNAS3'''''. Among the 3 OsNAS genes, '''''OsNAS1''''' and '''''OsNAS2''''' transcripts are markedly elevated in both roots and leaves in response to Fe deficiency, whereas '''''OsNAS3''''' expression is induced in roots but suppressed in leaves when the Fe supply is inadequate.
AP = Chromosome 7:29983257..29984766|
+
 
CDS = 29983344..29984375|
+
===Overexpression===
GCID = <gbrowseImage1>
+
* The researchers isolated activation-tagged mutant lines in which expression of a rice NAS gene, '''''OsNAS3''''', was increased by introducing 35S enhancer elements. Shoots and roots of the OsNAS3 activationtagged plants ('''''OsNAS3-D1''''') accumulated more Fe and Zn. Seeds from '''''OsNAS3-D1''''' plants grown on a paddy field contained fold). The NA level was increased 9.6-fold in OsNAS3-D1 seeds.
name=NC_008400:29983257..29984766
+
* Analysis by size exclusion chromatography coupled with inductively coupled plasma mass spectroscopy showed that WT and Os- '''''NAS3-D1''''' seeds contained equal amounts of Fe bound to IP6, whereas '''''OsNAS3-D1''''' had 7-fold more Fe bound to a low molecular mass, which was likely NA.
source=RiceChromosome07
+
* Furthermore, this activation led to increased tolerance to Fe and Zn deficiencies and to excess metal (Zn, Cu, and Ni) toxicities.
preset=GeneLocation
+
 
</gbrowseImage1>|
+
===Expression ===
GSID = <gbrowseImage2>
+
 
name=NC_008400:29983257..29984766
+
 
source=RiceChromosome07
+
===Evolution===
preset=GeneLocation
+
 
</gbrowseImage2>|
+
You can also add sub-section(s) at will.
CDNA = <cdnaseq>atgacggtggaagtggaggcggtgaccatggcgaaggaggagcagccggaggaggaggaggtgatcgagaagttggttgagaagatcaccgggctggcggcggccatcggcaagctgccgtcgctgagcccgtcgccggaggtgaacgcgctgttcacggagctggtgatgacctgcatcccgcccagcagcgtggacgtggagcagctgggggcggaggcgcaggacatgcgcggccgcctcatccgcctctgcgccgacgccgagggccacctcgaggcgcactactccgacgtcctcgccgcccacgacaacccgctcgaccacctcgccctcttcccctacttcaacaactacatccagctcgcccagctcgagtacgccctcctcgcccgccacctccccgccgccccgccgccctcccgcctcgccttcctcggctccggcccgctcccgctcagctccctcgtcctcgccgcccgccacctccccgccgcctccttccacaactacgacatctgcgccgacgccaaccgccgcgccagccgcctcgtccgcgccgaccgcgacctgtccgcgcgcatggccttccacacctccgacgtcgcccacgtcaccaccgacctcgccgcctacgacgtcgtgttcctggcggcgctggtgggtatggccgccgaggagaaggcgcgcatggtggagcacctcgggaagcacatggcgcccggcgccgccctggtggtgcggagcgcgcacggcgcccggggattcctgtaccccgtggtggacccggaggagatccgccgcggcggcttcgacgtgctcgccgtgcaccacccggagggcgaggtgatcaactccgtcatcatcgcgcgcaagccgcccgtggcggcgccggcgttggagggaggagacgcgcacgcgcacggccatggcgccgtggtgagccgtccatgccagcgctgcgagatggaggcgagggcgcaccagaagatggaggacatgtccgccatggagaagctgccctcctcgtag</cdnaseq>|
+
==Labs working on this gene==
AA = <aaseq>MTVEVEAVTMAKEEQPEEEEVIEKLVEKITGLAAAIGKLPSLSP                    SPEVNALFTELVMTCIPPSSVDVEQLGAEAQDMRGRLIRLCADAEGHLEAHYSDVLAA                    HDNPLDHLALFPYFNNYIQLAQLEYALLARHLPAAPPPSRLAFLGSGPLPLSSLVLAA                    RHLPAASFHNYDICADANRRASRLVRADRDLSARMAFHTSDVAHVTTDLAAYDVVFLA                    ALVGMAAEEKARMVEHLGKHMAPGAALVVRSAHGARGFLYPVVDPEEIRRGGFDVLAV                    HHPEGEVINSVIIARKPPVAAPALEGGDAHAHGHGAVVSRPCQRCEMEARAHQKMEDM                    SAMEKLPSS</aaseq>|
+
*Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang 790-784, Republic of Korea; *Plant and Soil Science Laboratory, Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, DK-1871 Frederiksberg, Denmark; and cGraduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan
DNA = <dnaseqindica>88..1119#tccaatccaaaagtataatcaagcaaagcagctcgatcgagtgttcgactgatcaccagttggagctaatcgatcgagagagagagtatgacggtggaagtggaggcggtgaccatggcgaaggaggagcagccggaggaggaggaggtgatcgagaagttggttgagaagatcaccgggctggcggcggccatcggcaagctgccgtcgctgagcccgtcgccggaggtgaacgcgctgttcacggagctggtgatgacctgcatcccgcccagcagcgtggacgtggagcagctgggggcggaggcgcaggacatgcgcggccgcctcatccgcctctgcgccgacgccgagggccacctcgaggcgcactactccgacgtcctcgccgcccacgacaacccgctcgaccacctcgccctcttcccctacttcaacaactacatccagctcgcccagctcgagtacgccctcctcgcccgccacctccccgccgccccgccgccctcccgcctcgccttcctcggctccggcccgctcccgctcagctccctcgtcctcgccgcccgccacctccccgccgcctccttccacaactacgacatctgcgccgacgccaaccgccgcgccagccgcctcgtccgcgccgaccgcgacctgtccgcgcgcatggccttccacacctccgacgtcgcccacgtcaccaccgacctcgccgcctacgacgtcgtgttcctggcggcgctggtgggtatggccgccgaggagaaggcgcgcatggtggagcacctcgggaagcacatggcgcccggcgccgccctggtggtgcggagcgcgcacggcgcccggggattcctgtaccccgtggtggacccggaggagatccgccgcggcggcttcgacgtgctcgccgtgcaccacccggagggcgaggtgatcaactccgtcatcatcgcgcgcaagccgcccgtggcggcgccggcgttggagggaggagacgcgcacgcgcacggccatggcgccgtggtgagccgtccatgccagcgctgcgagatggaggcgagggcgcaccagaagatggaggacatgtccgccatggagaagctgccctcctcgtaggcaggcatcgatgactgcttccatcgcttgctacctcaccagctcacctgataaatcacctcagttactatcgattaatcatttaccatgcattaattaagaagaaaacatatataccataattatctaccagtaaaacaaatctaatagtagtatttaataatctcgttggtaattaactgcagtcatgcatgaatgcatgccatattgcgtcgctatctttttttcccatgatgagactgatgagagagagagagaatatatgtcgctattgagtgttactgcttgattactgtactagtagcttattacaatcaaccattgtctctgttgcgtatttatgagtgtaagtggttaattttctgttgcagcataattaagttacctgtat</dnaseqindica>|
+
==References==
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001067242.1 RefSeq:Os07g0689600]|
+
<references>
}}
+
* <ref name="ref1">
[[Category:Genes]]
+
Lee S, Jeon US, Lee SJ, Kim YK, Persson DP, Husted S, Schjørring JK, Kakei Y,
[[Category:Japonica mRNA]]
+
Masuda H, Nishizawa NK, An G. Iron fortification of rice seeds through activation
[[Category:Oryza Sativa Japonica Group]]
+
of the nicotianamine synthase gene. Proc Natl Acad Sci U S A. 2009 Dec
[[Category:Japonica Genes]]
+
22;106(51):22014-9. doi: 10.1073/pnas.0910950106. PubMed PMID: 20080803; PubMed
[[Category:Japonica Chromosome 7]]
+
Central PMCID: PMC2799860.
[[Category:Chromosome 7]]
+
 
 +
</ref>
 +
</references>
 +
 
 +
 
 +
==Structured Information==
 +
[[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 7]]

Latest revision as of 07:17, 11 December 2016

The rice gene Os07g0689600 was reported as OsNAS3 in 2009[1] by researchers from Korea and Japan.

Annotated Information

Gene Symbol

  • Os07g0689600 <=> OsNAS3, NAS3

Function

  • Nicotianamine (NA) is synthesized by nicotianamine synthase (NAS). There are 3 OsNAS genes present in rice, OsNAS1, OsNAS2 and OsNAS3. Among the 3 OsNAS genes, OsNAS1 and OsNAS2 transcripts are markedly elevated in both roots and leaves in response to Fe deficiency, whereas OsNAS3 expression is induced in roots but suppressed in leaves when the Fe supply is inadequate.

Overexpression

  • The researchers isolated activation-tagged mutant lines in which expression of a rice NAS gene, OsNAS3, was increased by introducing 35S enhancer elements. Shoots and roots of the OsNAS3 activationtagged plants (OsNAS3-D1) accumulated more Fe and Zn. Seeds from OsNAS3-D1 plants grown on a paddy field contained fold). The NA level was increased 9.6-fold in OsNAS3-D1 seeds.
  • Analysis by size exclusion chromatography coupled with inductively coupled plasma mass spectroscopy showed that WT and Os- NAS3-D1 seeds contained equal amounts of Fe bound to IP6, whereas OsNAS3-D1 had 7-fold more Fe bound to a low molecular mass, which was likely NA.
  • Furthermore, this activation led to increased tolerance to Fe and Zn deficiencies and to excess metal (Zn, Cu, and Ni) toxicities.

Expression

Evolution

You can also add sub-section(s) at will.

Labs working on this gene

  • Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang 790-784, Republic of Korea; *Plant and Soil Science Laboratory, Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, DK-1871 Frederiksberg, Denmark; and cGraduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan

References

  1. Lee S, Jeon US, Lee SJ, Kim YK, Persson DP, Husted S, Schjørring JK, Kakei Y, Masuda H, Nishizawa NK, An G. Iron fortification of rice seeds through activation of the nicotianamine synthase gene. Proc Natl Acad Sci U S A. 2009 Dec 22;106(51):22014-9. doi: 10.1073/pnas.0910950106. PubMed PMID: 20080803; PubMed Central PMCID: PMC2799860.


Structured Information