Difference between revisions of "Os12g0188700"

From RiceWiki
Jump to: navigation, search
(Created page with "{{JaponicaGene| GeneName = Os12g0188700| Description = Similar to Thioredoxin (TRX)| Version = NM_001189897.1 GI:297728924 GeneID:9270622| Length = 1023 bp| Definition = ...")
 
(References)
 
(4 intermediate revisions by 2 users not shown)
Line 1: Line 1:
{{JaponicaGene|
+
The rice '''Os12g0188700''' was reported as ''' Ostrxm''' in 2008 <ref name="ref1" /> by researchers from the Korea.
GeneName = Os12g0188700|
+
<br>
Description = Similar to Thioredoxin (TRX)|
+
==Annotated Information==
Version = NM_001189897.1 GI:297728924 GeneID:9270622|
+
===Gene Symbol===
Length = 1023 bp|
+
*'''Os12g0188700 <=> Ostrxm'''
Definition = Oryza sativa Japonica Group Os12g0188700, complete gene.|
+
<br>
Source = Oryza sativa Japonica Group
+
===Function===
 +
*The pleiotropic effects of '''Ostrxm''' RNAi suggest that Ostrxm plays an important role in the redox regulation of chloroplast target proteins involved in diverse physiological functions.
 +
<br>
 +
===Mutant===
 +
*RNA interference (RNAi) of '''Ostrxm''' resulted in rice plants with developmental defects, including semidwarfism, pale-green leaves, abnormal chloroplast structure, and reduced carotenoid and chlorophyll content. '''Ostrxm''' RNAi plants showed remarkably decreased Fv/Fm values under high irradiance conditions (1,000 mmol m22 s21) with delayed recovery. Two-dimensional electrophoresis and matrix-assisted laser-desorption/ionization time-of-flight analysis showed that the levels of several chloroplast proteins critical for photosynthesis and biogenesis were significantly decreased in '''Ostrxm''' RNAi plants. Furthermore, 2-Cys peroxiredoxin, a known target of thioredoxin, was present in oxidized forms, and hydrogen peroxide levels were increased in '''Ostrxm''' RNAi plants.
 +
<br>
  
  ORGANISM  Oryza sativa Japonica Group
+
==Labs working on this gene==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
*Division of Applied Life Science (BK21 Program), EB-NCRC and Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National University, Jinju 660–701, Korea (Y.H.C., J.C.M., J.H.P., W.I.F., H.H.J.,J.R.L., Y.M.L., S.T.K., C.O.L., J.-Y.K., D.-J.Y., K.O.L., S.Y.L.);  
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
*Department of Molecular Biology, Pusan National University, Busan 609–735, Korea (H.-S.K., I.S.Z, C.-H.L.);
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
*School of Life Sciences and Biotechnology, Korea University, Seoul 136–701, Korea (Y.-Y.C.)
|
+
<br>
Chromosome = [[:category:Japonica Chromosome 12|Chromosome 12]]|
+
==References==
AP = Chromosome 12:4460770..4461792|
+
<references>
CDS = 4461112..4461431,4461517..4461715|
+
<ref name="ref1">
GCID = <gbrowseImage1>
+
Abnormal Chloroplast Development and Growth Inhibition in Rice Thioredoxin m Knock-Down Plants
name=NC_008405:4460770..4461792
+
</ref>
source=RiceChromosome12
+
 
preset=GeneLocation
+
</references>
</gbrowseImage1>|
+
<br>
GSID = <gbrowseImage2>
+
 
name=NC_008405:4460770..4461792
+
==Structured Information==
source=RiceChromosome12
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 12]]
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggcgttggagacgtgcttcagagcctgggcgactctgcacgccccacagccaccgtcctccggcggcagtagggacagactcctcctctccggcgccggcagcagccagtccaagccaaggttgtccgtcgcctcgccgtcaccgctccgacctgcctcccgcttcgcctgccagtgcagcaacgtcgtcgacgaagtggtggtggcggacgagaagaactgggacagcatggtgctggggagcgaggcgccggtgctggtggagttctgggcaccgtggtgcggaccgtgcaggatgatcgcgccggtgatcgacgagctggccaaggagtacgtcggcaagatcaagtgctgcaaggtgaacacggacgactcaccaaacatcgccaccaactacggcatccggagcatccccaccgtcctcatgttcaagaacggcgagaagaaggagagcgtcatcggcgccgtccccaagaccaccctcgccaccatcatcgacaagtacgtcagcagctga</cdnaseq>|
 
AA = <aaseq>MALETCFRAWATLHAPQPPSSGGSRDRLLLSGAGSSQSKPRLSV                    ASPSPLRPASRFACQCSNVVDEVVVADEKNWDSMVLGSEAPVLVEFWAPWCGPCRMIA                    PVIDELAKEYVGKIKCCKVNTDDSPNIATNYGIRSIPTVLMFKNGEKKESVIGAVPKT                    TLATIIDKYVSS</aaseq>|
 
DNA = <dnaseqindica>362..681#78..276#acaaaaaattttctcctcctctttctcttctctctgtgtcactgcgtgtgaggagcgtagcttagagtgagaaaataatggcgttggagacgtgcttcagagcctgggcgactctgcacgccccacagccaccgtcctccggcggcagtagggacagactcctcctctccggcgccggcagcagccagtccaagccaaggttgtccgtcgcctcgccgtcaccgctccgacctgcctcccgcttcgcctgccagtgcagcaacgtcgtcgacgaaggtaaaacacatgtttgaccattcgtcatattctggtgcaaaacaaaacgaaaaccatcgtatgtgtgcgtgtggggtcgtggcagtggtggtggcggacgagaagaactgggacagcatggtgctggggagcgaggcgccggtgctggtggagttctgggcaccgtggtgcggaccgtgcaggatgatcgcgccggtgatcgacgagctggccaaggagtacgtcggcaagatcaagtgctgcaaggtgaacacggacgactcaccaaacatcgccaccaactacggcatccggagcatccccaccgtcctcatgttcaagaacggcgagaagaaggagagcgtcatcggcgccgtccccaagaccaccctcgccaccatcatcgacaagtacgtcagcagctgattgcatcatcatcgtcgtcttcttcctcttcttcttcagctgcatcaatcaaatcagacttgatcgatcagagcttcgtttgtaagttgtaactaagctaccccctgctttgcctctctatgtgtatcgccagccacccctttctcttcatcgtccttaattgttgtaatcctactactccatggaatcaatactgtaactattattgattgatgataccatcttttgactagcaaagaggaatcaaactgtgctacatatacatatatgatggccacatctgtttgaactttgattgtatatgcttcaaggcatcaagcggtaatcagggcaattcaattc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001189897.1 RefSeq:Os12g0188700]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 12]]
 
[[Category:Chromosome 12]]
 

Latest revision as of 06:06, 12 December 2016

The rice Os12g0188700 was reported as Ostrxm in 2008 [1] by researchers from the Korea.

Annotated Information

Gene Symbol

  • Os12g0188700 <=> Ostrxm


Function

  • The pleiotropic effects of Ostrxm RNAi suggest that Ostrxm plays an important role in the redox regulation of chloroplast target proteins involved in diverse physiological functions.


Mutant

  • RNA interference (RNAi) of Ostrxm resulted in rice plants with developmental defects, including semidwarfism, pale-green leaves, abnormal chloroplast structure, and reduced carotenoid and chlorophyll content. Ostrxm RNAi plants showed remarkably decreased Fv/Fm values under high irradiance conditions (1,000 mmol m22 s21) with delayed recovery. Two-dimensional electrophoresis and matrix-assisted laser-desorption/ionization time-of-flight analysis showed that the levels of several chloroplast proteins critical for photosynthesis and biogenesis were significantly decreased in Ostrxm RNAi plants. Furthermore, 2-Cys peroxiredoxin, a known target of thioredoxin, was present in oxidized forms, and hydrogen peroxide levels were increased in Ostrxm RNAi plants.


Labs working on this gene

  • Division of Applied Life Science (BK21 Program), EB-NCRC and Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National University, Jinju 660–701, Korea (Y.H.C., J.C.M., J.H.P., W.I.F., H.H.J.,J.R.L., Y.M.L., S.T.K., C.O.L., J.-Y.K., D.-J.Y., K.O.L., S.Y.L.);
  • Department of Molecular Biology, Pusan National University, Busan 609–735, Korea (H.-S.K., I.S.Z, C.-H.L.);
  • School of Life Sciences and Biotechnology, Korea University, Seoul 136–701, Korea (Y.-Y.C.)


References

  1. Abnormal Chloroplast Development and Growth Inhibition in Rice Thioredoxin m Knock-Down Plants


Structured Information