Difference between revisions of "Os10g0578200"

From RiceWiki
Jump to: navigation, search
(Created page with "{{JaponicaGene| GeneName = Os10g0578200| Description = Similar to CSLD2 (Fragment)| Version = NM_001072030.1 GI:115483655 GeneID:4349505| Length = 1231 bp| Definition = O...")
 
 
(4 intermediate revisions by 3 users not shown)
Line 1: Line 1:
{{JaponicaGene|
+
The rice gene Os10g0578200 was reported as '''''OsCSLD1''''' in 2007<ref name="ref1" /> by researchers from Korea and UK.
GeneName = Os10g0578200|
 
Description = Similar to CSLD2 (Fragment)|
 
Version = NM_001072030.1 GI:115483655 GeneID:4349505|
 
Length = 1231 bp|
 
Definition = Oryza sativa Japonica Group Os10g0578200, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
+
==Annotated Information==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
===Gene Symbol===
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
*'''''Os10g0578200 <=> csld1, OsCSLD1, OsCslD1
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
 
|
+
===Function===
Chromosome = [[:category:Japonica Chromosome 10|Chromosome 10]]|
+
* '''''Oryza sativa cellulose synthase-like D1 (OsCSLD1)''''' gene is required for root hair development.
AP = Chromosome 10:23520337..23521567|
+
* '''''OsCSLD1''''' function is required for hair elongation but not initiation.
CDS = 23520339..23520404,23520492..23521199|
+
* '''''OsCSLD1''''' is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene '''''KOJAK/AtCSLD3''''' is required for root hair elongation and is expressed in the root hair, it appears that '''''OsCSLD1''''' may be the functional ortholog of '''''KOJAK/AtCSLD3''''' and that these two genes represent the root hair-specific members of this family of proteins.
GCID = <gbrowseImage1>
+
===Mutation===
name=NC_008403:23520337..23521567
+
* In these '''''csld1''''' mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that '''''OsCSLD1''''' function is required for hair elongation but not initiation.
source=RiceChromosome10
+
===Expression ===
preset=GeneLocation
+
* Both gene trap expression pattern and in situ hybridization analyses indicate that '''''OsCSLD1''''' is expressed in only root hair cells.
</gbrowseImage1>|
+
 
GSID = <gbrowseImage2>
+
===Evolution===
name=NC_008403:23520337..23521567
+
 
source=RiceChromosome10
+
You can also add sub-section(s) at will.
preset=GeneLocation
+
==Labs working on this gene==
</gbrowseImage2>|
+
* Division of Applied Life Science, Plant Molecular Biology and Biotechnology Research Center, Environmental Biotechnology National Core Research Center, Gyeongsang National University, Jinju 660–701, Korea (C.M.K., S.H.P., B.I.J., S.H.P., S.J.P., H.L.P., C.-d.H.);
CDNA = <cdnaseq>gccactggctccgtcgagatcttcttctcacgcaacaacgcactcttcgcttcctcaaagatgaaggttctccagcgcatcgcttacctcaacgttggcatctaccccttcacctccgtcttcctcatcgtctactgcttcctcccggcgctctccctcttctcggggcagttcatcgtgcagacgctcaacgtcaccttcctcacctacctgctcatcatcaccatcacgctctgcctcctggccatgctggagatcaagtggtccggcatcgcgctggaggagtggtggcggaacgagcagttctggctcatcggcggaaccagcgcccacctcgccgccgtcctgcagggccttctcaaggtcatcgccggcatcgagatctccttcaccctcacctccaagcagctcggcgacgacgtcgacgacgagttcgccgagctctacgcggtcaagtggacgtccctcatgataccgccgctcaccatcataatgatcaacctcgtcgccatcgccgtcggcttcagccgcaccatctacagcaccatcccgcagtggagcaagcttctcggtggagtcttcttcagcttctgggtcctcgcgcatctctaccccttcgccaagggcctcatgggcaggaggggaaggacacccaccatcgtctacgtctggtctggcctcgtcgccatcaccatctccttgctctggattgcaatcaagcctccttctgcacaagccaactcacagctaggaggatccttctctttcccctga</cdnaseq>|
+
* Rice Functional Genomics, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441–707, Korea (M.Y.E.);
AA = <aaseq>ATGSVEIFFSRNNALFASSKMKVLQRIAYLNVGIYPFTSVFLIV                    YCFLPALSLFSGQFIVQTLNVTFLTYLLIITITLCLLAMLEIKWSGIALEEWWRNEQF                    WLIGGTSAHLAAVLQGLLKVIAGIEISFTLTSKQLGDDVDDEFAELYAVKWTSLMIPP                    LTIIMINLVAIAVGFSRTIYSTIPQWSKLLGGVFFSFWVLAHLYPFAKGLMGRRGRTP                    TIVYVWSGLVAITISLLWIAIKPPSAQANSQLGGSFSFP</aaseq>|
+
* Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4 7UH, United Kingdom (L.D.)
DNA = <dnaseqindica>3..68#156..863#gggccactggctccgtcgagatcttcttctcacgcaacaacgcactcttcgcttcctcaaagatgaaggtacctagcttgctattcgatcgattatttttcttcttcttcttcttccgctgccgccaaacaaacaattatccattgcatttgcaggttctccagcgcatcgcttacctcaacgttggcatctaccccttcacctccgtcttcctcatcgtctactgcttcctcccggcgctctccctcttctcggggcagttcatcgtgcagacgctcaacgtcaccttcctcacctacctgctcatcatcaccatcacgctctgcctcctggccatgctggagatcaagtggtccggcatcgcgctggaggagtggtggcggaacgagcagttctggctcatcggcggaaccagcgcccacctcgccgccgtcctgcagggccttctcaaggtcatcgccggcatcgagatctccttcaccctcacctccaagcagctcggcgacgacgtcgacgacgagttcgccgagctctacgcggtcaagtggacgtccctcatgataccgccgctcaccatcataatgatcaacctcgtcgccatcgccgtcggcttcagccgcaccatctacagcaccatcccgcagtggagcaagcttctcggtggagtcttcttcagcttctgggtcctcgcgcatctctaccccttcgccaagggcctcatgggcaggaggggaaggacacccaccatcgtctacgtctggtctggcctcgtcgccatcaccatctccttgctctggattgcaatcaagcctccttctgcacaagccaactcacagctaggaggatccttctctttcccctgatatacatatattctcattccacacacccaatccagactacctgtctctctgctatctgcttgcttaggattcattcatatgctagctggtcgatcgagctaccgcagcctagggaacatgatcatatcacccacagtctgtttgcttcatggagcaaactgcacttcaccccagtccagatctgcttcttcacagtgagtgagatcactatttttgcttgtttgtgatttttttttctaaaattgtttagagctcattgtcatttgaatggcattcctagaaaagggagaaagaaaagacacttgacatcaacacaggtgtaatacattgttactagagaatcggcaatataatgttactagagtatc</dnaseqindica>|
+
==References==
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001072030.1 RefSeq:Os10g0578200]|
+
<references>
}}
+
* <ref name="ref1">
[[Category:Genes]]
+
Kim CM, Park SH, Je BI, Park SH, Park SJ, Piao HL, Eun MY, Dolan L, Han CD.
[[Category:Japonica mRNA]]
+
OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair
[[Category:Oryza Sativa Japonica Group]]
+
morphogenesis in rice. Plant Physiol. 2007 Mar;143(3):1220-30. PubMed PMID:
[[Category:Japonica Genes]]
+
17259288; PubMed Central PMCID: PMC1820921.
[[Category:Japonica Chromosome 10]]
+
 
[[Category:Chromosome 10]]
+
</ref>
 +
</references>
 +
 
 +
 
 +
==Structured Information==
 +
[[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 10]]

Latest revision as of 09:28, 12 December 2016

The rice gene Os10g0578200 was reported as OsCSLD1 in 2007[1] by researchers from Korea and UK.

Annotated Information

Gene Symbol

  • Os10g0578200 <=> csld1, OsCSLD1, OsCslD1

Function

  • Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development.
  • OsCSLD1 function is required for hair elongation but not initiation.
  • OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins.

Mutation

  • In these csld1 mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation.

Expression

  • Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells.

Evolution

You can also add sub-section(s) at will.

Labs working on this gene

  • Division of Applied Life Science, Plant Molecular Biology and Biotechnology Research Center, Environmental Biotechnology National Core Research Center, Gyeongsang National University, Jinju 660–701, Korea (C.M.K., S.H.P., B.I.J., S.H.P., S.J.P., H.L.P., C.-d.H.);
  • Rice Functional Genomics, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441–707, Korea (M.Y.E.);
  • Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4 7UH, United Kingdom (L.D.)

References

  1. Kim CM, Park SH, Je BI, Park SH, Park SJ, Piao HL, Eun MY, Dolan L, Han CD. OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair morphogenesis in rice. Plant Physiol. 2007 Mar;143(3):1220-30. PubMed PMID: 17259288; PubMed Central PMCID: PMC1820921.


Structured Information