Difference between revisions of "Os01g0750100"

From RiceWiki
Jump to: navigation, search
 
(4 intermediate revisions by 2 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice '''''Os01g0750100''''' was reported as '''''OsWRKY13''''' in 2007 <ref name="ref1" /> by researchers from China.  
  
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Please input function information here.
+
* '''''OsWRKY13''''' is a gene that plays a pivotal role in disease resistance.
 +
* '''''OsWRKY13''''' bound to the promoters of its own and at least three other genes in SA- and JA-dependent signaling pathways. Its DNA-binding activity was influenced by pathogen infection.
 +
* '''''OsWRKY13''''', as an activator of the SA-dependent pathway and a suppressor of JA-dependent pathways, mediates rice resistance by directly or indirectly regulating the expression of a subset of genes acting both upstream and downstream of SA and JA.
 +
* Furthermore, OsWRKY13 will provide a transgenic tool for engineering wider-spectrum and whole-growth-stage resistance rice in breeding programs.
  
===Expression===
+
===Phenotypic analysis===
Please input expression information here.
+
* Overexpression of OsWRKY13 can enhance rice resistance to bacterial blight and fungal blast, two of the most devastating diseases of rice worldwide, at both the seedling and adult stages, and shows no influence on the fertility.
 
+
* This overexpression was accompanied by the activation of salicylic acid (SA) synthesis-related genes and SA-responsive genes and the suppression of jasmonic acid (JA) synthesis- related genes and JA-responsive genes.
===Evolution===
 
Please input evolution information here.
 
  
 
You can also add sub-section(s) at will.
 
You can also add sub-section(s) at will.
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
* National Key Laboratory of Crop Genetic Improvement, National Center for Plant Gene Research (Wuhan), Huazhong
 +
Agricultural University, Wuhan 430070, China
  
 
==References==
 
==References==
Please input cited references here.
+
<references>
 +
* <ref name="ref1">
 +
Qiu D, Xiao J, Ding X, Xiong M, Cai M, Cao Y, Li X, Xu C, Wang S. OsWRKY13
 +
mediates rice disease resistance by regulating defense-related genes in
 +
salicylate- and jasmonate-dependent signaling. Mol Plant Microbe Interact. 2007
 +
May;20(5):492-9. PubMed PMID: 17506327.
 +
</ref>
 +
</references>
  
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]]
GeneName = Os01g0750100|
 
Description = Similar to WRKY transcription factor-like (WRKY transcription factor 13) (WRKY13)|
 
Version = NM_001050786.1 GI:115439942 GeneID:4324624|
 
Length = 1605 bp|
 
Definition = Oryza sativa Japonica Group Os01g0750100, complete gene.|
 
Source = Oryza sativa Japonica Group
 
 
 
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
 
AP = Chromosome 1:33164978..33166582|
 
CDS = 33165534..33165549,33165618..33165719,33165869..33166018,33166114..33166316|
 
GCID = <gbrowseImage1>
 
name=NC_008394:33164978..33166582
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008394:33164978..33166582
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggcggccggagaggaggtgatggatcggtcgacgtcggccgaggacgggtactgcagcgccggcacggactcgccgcgggcggagtccgtcgacgagcaaggggccgccgaggagtcgtcgccccggggagggcagaagcgggagctcccctcgccgtcggcttcgccgtcgtccccgctgccacctgccgcgaagcgcagccggaggtcagtggagaagcgggtggtgtccgtgccgatcgcggagtgcggcgaccggccgaagggcgccggggaggggccgccgccgtcggactcgtgggcctggcgcaagtacggccagaagcccatcaagggctctccctacccaagggggtactacaggtgcagtagctccaaggggtgtccggcgaggaagcaggtggagcgcagccgcgccgaccccaccgtgctgctcgtcacctactccttcgacggcgccaaagcctga</cdnaseq>|
 
AA = <aaseq>MAAGEEVMDRSTSAEDGYCSAGTDSPRAESVDEQGAAEESSPRG                    GQKRELPSPSASPSSPLPPAAKRSRRSVEKRVVSVPIAECGDRPKGAGEGPPPSDSWA                    WRKYGQKPIKGSPYPRGYYRCSSSKGCPARKQVERSRADPTVLLVTYSFDGAKA</aaseq>|
 
DNA = <dnaseqindica>1034..1049#864..965#565..714#267..469#tttccatcccctccatcatgagctccaattagccgcacaccgatcccctcctcttcttcccccccttctcctctctcctctttttttcctcatccgtgcgcgatactgcgcttagtttgtgggtggggggagtgatcatcaccaaagccacaaagggggcgcggagagatattatatattctttgggaaagcgttggattagtttttctcgctttgggctttttatccggagttggagtgtgtgtgcgccgggagtggtggtggtgatggcggccggagaggaggtgatggatcggtcgacgtcggccgaggacgggtactgcagcgccggcacggactcgccgcgggcggagtccgtcgacgagcaaggggccgccgaggagtcgtcgccccggggagggcagaagcgggagctcccctcgccgtcggcttcgccgtcgtccccgctgccacctgccgcgaagcgcaggtacggataatattatggctcggtctgcgattgattaaagccctaggtaggatttagggatagaggattgattggtgtttggttggtttgagcagccggaggtcagtggagaagcgggtggtgtccgtgccgatcgcggagtgcggcgaccggccgaagggcgccggggaggggccgccgccgtcggactcgtgggcctggcgcaagtacggccagaagcccatcaagggctctccctacccaaggtaattaggctttatattcagtttggttgatattcttgagcctgttgattagttaccgtgctgattaatcactgcaattagatcagttaaacggttgttgaagtggcaagatttaatttgggtttgttgcttgtgtttattatgctcagggggtactacaggtgcagtagctccaaggggtgtccggcgaggaagcaggtggagcgcagccgcgccgaccccaccgtgctgctcgtcacctactccttcgagcacaaccacccgtggccgcagcccaagagcagcagctgccacgcgagcaagtcgtctccccggtcgacggcgccaaagcctgagccggtggctgacggacagcaccccgagccagcggagaacgaatcgtcggcgtcggcggagctggaggtaccggagccggagccggagcaggaatctgagccggttgtgaagcaggaggaggagcagaaggaggaacagaaggctgtggttgagccggcggcggtcacaaccacggtggcgccggcgccggcggtcgaggaggaggatgagaacttcgacttcggatggatcgaccagtaccacccgacgtggcaccggtcgtacgcgccgctgctgccgccggaggagtgggagcgcgagctgcaaggggacgacgcgctgttcgcggggctcggcgagctcccggagtgcgccgtcgtgttcggccgccggcgcgagctcggcctggcggccaccgcgccgtgctcctgatgatcacctcctcttttctttttcctccccttttacaatttcccttttttttttttgcttttctttagttctccttggagtaatttggattggaggttagtacatagcttgggtgatcaatgggagtgagtggcttaactgttc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001050786.1 RefSeq:Os01g0750100]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 1]]
 
[[Category:Chromosome 1]]
 

Latest revision as of 07:20, 6 March 2017

The rice Os01g0750100 was reported as OsWRKY13 in 2007 [1] by researchers from China.

Annotated Information

Function

  • OsWRKY13 is a gene that plays a pivotal role in disease resistance.
  • OsWRKY13 bound to the promoters of its own and at least three other genes in SA- and JA-dependent signaling pathways. Its DNA-binding activity was influenced by pathogen infection.
  • OsWRKY13, as an activator of the SA-dependent pathway and a suppressor of JA-dependent pathways, mediates rice resistance by directly or indirectly regulating the expression of a subset of genes acting both upstream and downstream of SA and JA.
  • Furthermore, OsWRKY13 will provide a transgenic tool for engineering wider-spectrum and whole-growth-stage resistance rice in breeding programs.

Phenotypic analysis

  • Overexpression of OsWRKY13 can enhance rice resistance to bacterial blight and fungal blast, two of the most devastating diseases of rice worldwide, at both the seedling and adult stages, and shows no influence on the fertility.
  • This overexpression was accompanied by the activation of salicylic acid (SA) synthesis-related genes and SA-responsive genes and the suppression of jasmonic acid (JA) synthesis- related genes and JA-responsive genes.

You can also add sub-section(s) at will.

Labs working on this gene

  • National Key Laboratory of Crop Genetic Improvement, National Center for Plant Gene Research (Wuhan), Huazhong

Agricultural University, Wuhan 430070, China

References

  1. Qiu D, Xiao J, Ding X, Xiong M, Cai M, Cao Y, Li X, Xu C, Wang S. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol Plant Microbe Interact. 2007 May;20(5):492-9. PubMed PMID: 17506327.

Structured Information