|
|
| (16 intermediate revisions by 3 users not shown) |
| Line 2: |
Line 2: |
| | | | |
| | ==Annotated Information== | | ==Annotated Information== |
| − | ===Function===
| + | |
| − | The overexpresion of the rice gene -- OsAt10(LOC_Os06g39390) -- can effect the hydroxycinnamic acid content and saccharification in the rice cell wall.
| |
| | | | |
| | ===Expression=== | | ===Expression=== |
| − | Please input expression information here.
| + | |
| | | | |
| | ===Evolution=== | | ===Evolution=== |
| − | Please input evolution information here.
| |
| | | | |
| − | You can also add sub-section(s) at will.
| |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| − | Please input related labs here.
| + | |
| | | | |
| | ==References== | | ==References== |
| − | Please input cited references here.
| + | |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| |
| − | GeneName = Os06g0594600|
| |
| − | Description = The start codon is not identified.|
| |
| − | Version = NM_001064516.2 GI:297606110 GeneID:4341427|
| |
| − | Length = 1126 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os06g0594600, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 6|Chromosome 6]]|
| |
| − | AP = Chromosome 6:24256206..24257331|
| |
| − | CDS = 24256486..24257331|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008399:24256206..24257331
| |
| − | source=RiceChromosome06
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008399:24256206..24257331
| |
| − | source=RiceChromosome06
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>gatttgcaggtgacgacgttcacctgcggcggcttcgtgatcgggctgcgcaccaaccacgcggtggcggacggcaccggcgccgcccagttcatgaacgccgtcggcgacctcgcccgcggcctcccggagccgcgggtgaagccgatctgggcgcgcgaccgcttcccggacccggacatcaagcccggcccgctgccggagctccccgtgctgccgctccagtacatcgccttcgacttccccgccgcctacctcggcaagctcaaggcgcagtacgccgccaccgccggcgccagcaagatctgctccgccttcgacatcgtcatcgccaagctctggcagtgccggacgcgcgccatcgccgccgaccccgccgcggccgtcaagctctgcttcttcgccagcgcccgccaggtgctcggcctggagaccggctactggggcaacgccatcttcccggtgaaggtgtccgcggcggcgggggaggtggcggcgtcgtcggtgatcgagctcgtcggcgtggtccgggaggcgaagcggcggatggccggcgagtgcctgcgctgggcggaggggcgcaccggcggcgccgacccgttccagatgacgttcgactacgagtccgtgtacgtgtcggactggagcaagctcgggttcaacgacgtcgactacgggtacggcgcgccgtcggcggcggggccgctggtgaactgcgacctcatctcgtcggtgatcgtcatgcgggcgccggcgccgctcgccggcacgcggctgctggcgagctgcgtcaccaaggagcacgccgacgacttcgccgccaggatgagggaggatctcgtctaa</cdnaseq>|
| |
| − | AA = <aaseq>DLQVTTFTCGGFVIGLRTNHAVADGTGAAQFMNAVGDLARGLPE PRVKPIWARDRFPDPDIKPGPLPELPVLPLQYIAFDFPAAYLGKLKAQYAATAGASKI CSAFDIVIAKLWQCRTRAIAADPAAAVKLCFFASARQVLGLETGYWGNAIFPVKVSAA AGEVAASSVIELVGVVREAKRRMAGECLRWAEGRTGGADPFQMTFDYESVYVSDWSKL GFNDVDYGYGAPSAAGPLVNCDLISSVIVMRAPAPLAGTRLLASCVTKEHADDFAARM REDLV</aaseq>|
| |
| − | DNA = <dnaseqindica>1..846#gatttgcaggtgacgacgttcacctgcggcggcttcgtgatcgggctgcgcaccaaccacgcggtggcggacggcaccggcgccgcccagttcatgaacgccgtcggcgacctcgcccgcggcctcccggagccgcgggtgaagccgatctgggcgcgcgaccgcttcccggacccggacatcaagcccggcccgctgccggagctccccgtgctgccgctccagtacatcgccttcgacttccccgccgcctacctcggcaagctcaaggcgcagtacgccgccaccgccggcgccagcaagatctgctccgccttcgacatcgtcatcgccaagctctggcagtgccggacgcgcgccatcgccgccgaccccgccgcggccgtcaagctctgcttcttcgccagcgcccgccaggtgctcggcctggagaccggctactggggcaacgccatcttcccggtgaaggtgtccgcggcggcgggggaggtggcggcgtcgtcggtgatcgagctcgtcggcgtggtccgggaggcgaagcggcggatggccggcgagtgcctgcgctgggcggaggggcgcaccggcggcgccgacccgttccagatgacgttcgactacgagtccgtgtacgtgtcggactggagcaagctcgggttcaacgacgtcgactacgggtacggcgcgccgtcggcggcggggccgctggtgaactgcgacctcatctcgtcggtgatcgtcatgcgggcgccggcgccgctcgccggcacgcggctgctggcgagctgcgtcaccaaggagcacgccgacgacttcgccgccaggatgagggaggatctcgtctaatataccatggccgcccccaataacattattagtcacgtacaatattgtcactgaatattaatttgttcgtgtatatctattgtggtatgtattttttttttcataggaaaaaagtagtagtacgacaataggtagctgggagctacctaatatcgacctctggtttgagagtaagtgagcgagcgagagatgtaaaccacctcagtttttaccgtgctttgtgacatgcgtggtacagtactggtactattaatcattggccgtgaaaaattatctaccc</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001064516.2 RefSeq:Os06g0594600]|
| |
| − | }}
| |
| | [[Category:Genes]] | | [[Category:Genes]] |
| | [[Category:Japonica mRNA]] | | [[Category:Japonica mRNA]] |