Difference between revisions of "Os08g0174700"
| (One intermediate revision by the same user not shown) | |||
| Line 13: | Line 13: | ||
Using a set of OsSERK1 primers (K-1; 5’AT(CT)AT(ATC)CATCG(AT)GATGTCAA3’ and K6-2; 5’CCATCTTGGGGCGTTCTGTG3’, where nucleotides in parentheses are a mixture). Actin (RAc-1; 5’AACTGGGATGATATGGAGAA3’, RAc-2; 5’CCTCCAATCCAGACACTGTA3’) was used as an internal control. The result showed that OsSERK1 was expressed in all organs and calli examined with different levels.Expression of OsSERK1 was relatively strong in a 1 DAP flower which contained a very early embryo, a leaf blade and a shoot apex<ref name="ref3" />. A callus on a regeneration medium with both cytokinin and auxin did not show significant change of the level of the OsSERK1expression in comparison to a callus on a callus-inducing medium(Fig.3 ).[[File:Expression of OsSERK1 and in various organs of rice.jpg|right|thumb|200px|''Fig.3 Expression of OsSERK1 and in various organs of rice(Poly(A)+RNAs isolated from the indicated organs were reversetranscribed and used as templates of the PCR. RT-PCR products were detected by Southern blot (OsSERK1) or ethidium bromide staining (actin). + and–indicate whether reverse transcriptase was add). (from reference <ref name="ref3" />).'']] | Using a set of OsSERK1 primers (K-1; 5’AT(CT)AT(ATC)CATCG(AT)GATGTCAA3’ and K6-2; 5’CCATCTTGGGGCGTTCTGTG3’, where nucleotides in parentheses are a mixture). Actin (RAc-1; 5’AACTGGGATGATATGGAGAA3’, RAc-2; 5’CCTCCAATCCAGACACTGTA3’) was used as an internal control. The result showed that OsSERK1 was expressed in all organs and calli examined with different levels.Expression of OsSERK1 was relatively strong in a 1 DAP flower which contained a very early embryo, a leaf blade and a shoot apex<ref name="ref3" />. A callus on a regeneration medium with both cytokinin and auxin did not show significant change of the level of the OsSERK1expression in comparison to a callus on a callus-inducing medium(Fig.3 ).[[File:Expression of OsSERK1 and in various organs of rice.jpg|right|thumb|200px|''Fig.3 Expression of OsSERK1 and in various organs of rice(Poly(A)+RNAs isolated from the indicated organs were reversetranscribed and used as templates of the PCR. RT-PCR products were detected by Southern blot (OsSERK1) or ethidium bromide staining (actin). + and–indicate whether reverse transcriptase was add). (from reference <ref name="ref3" />).'']] | ||
2.OsSERK genes were expressed in various organs but with some tissue specificity | 2.OsSERK genes were expressed in various organs but with some tissue specificity | ||
| − | The OsSERK1 promoter showed reporter gene activities in some specific tissues in a germinating seed, leaf and root, but not in a developing embryo<ref name="ref3" />. This promoter activity suggests that OsSERK1 may have roles in non-embryonic tissues rather than in the embryo<ref name="ref3" />.OsSERK1 might also be involved in signaling of or response to phytohormones in these tissues(Fig.4 ). | + | The OsSERK1 promoter showed reporter gene activities in some specific tissues in a germinating seed, leaf and root, but not in a developing embryo<ref name="ref3" />. This promoter activity suggests that OsSERK1 may have roles in non-embryonic tissues rather than in the embryo<ref name="ref3" />.OsSERK1 might also be involved in signaling of or response to phytohormones in these tissues(Fig.4 ). |
3.Rice SERKs are involved in BR signalling | 3.Rice SERKs are involved in BR signalling | ||
| − | Overexpress the OsSERK1 rice gene in a weak BRI1 mutant,bri1-5.The transgenic Arabidopsis lines ectopically expressing OsSERK1 partially rescued the defective phenotypes of bri1-5(Fig.9). | + | Overexpress the OsSERK1 rice gene in a weak BRI1 mutant,bri1-5.The transgenic Arabidopsis lines ectopically expressing OsSERK1 partially rescued the defective phenotypes of bri1-5(Fig.9).Compared to bri1-5, transgenic plants expressing OsSERK1 showed larger statures, longer petioles and earlier flowering phenotypes<ref name="ref1" />.The expression of CPD has been widely used as a molecular marker to detect the effectiveness of the BR signalling pathway <ref name="ref5" />. BRI1 mutants usually show higher CPD expression levels than that of wild-type plants. Compared to bri1-5, the transgenic lines expressing OsSERKs showed significantly decreased expression of CPD (Fig.10).These results indicated that OsSERKs, like AtBAK1, can partially rescue bri1-5 mutant phenotypes.Functionally, OsSERK1 is the closest homolog of AtBAK1 in rice. Therefore, we named it as OsBAK1<ref name="ref1" />. |
4.The subcellular localization of OsBAK1 protein | 4.The subcellular localization of OsBAK1 protein | ||
The OsBAK1 protein in onion epidermis cells is located at plasma membrane<ref name="ref1" /> (Fig.5) | The OsBAK1 protein in onion epidermis cells is located at plasma membrane<ref name="ref1" /> (Fig.5) | ||
| Line 21: | Line 21: | ||
Full length OsBAK1,the extracellular domain (OsBAK1-ECD), the intracellular domain (OsBAK1-ICD), and a truncated intracellular domain (OsBAK1-ICDD)(Fig.11) | Full length OsBAK1,the extracellular domain (OsBAK1-ECD), the intracellular domain (OsBAK1-ICD), and a truncated intracellular domain (OsBAK1-ICDD)(Fig.11) | ||
===Evolution=== | ===Evolution=== | ||
| − | Phylogenetic analysis and suppression of a weak Arabidopsis mutant bri1-5 indicated that OsBAK1 (Os08g0174700) is the closest relative of Arabidopsis BAK1(AtBAK1). Genetic, physiological, and biochemical analyses all suggest that the function of OsBAK1 is conserved with AtBAK1<ref name="ref3" />(Fig.6). | + | Phylogenetic analysis and suppression of a weak Arabidopsis mutant bri1-5 indicated that OsBAK1 (Os08g0174700) is the closest relative of Arabidopsis BAK1(AtBAK1). Genetic, physiological, and biochemical analyses all suggest that the function of OsBAK1 is conserved with AtBAK1<ref name="ref3" />(Fig.6). |
Phylogenetic analysis of SERK proteins in Arabidopsis and rice. | Phylogenetic analysis of SERK proteins in Arabidopsis and rice. | ||
| − | In order to search for AtBAK1 orthologs among the rice genes that were reported to be as OsSERKs or OsSERLs in the public database using the amino acid sequence of AtBAK1 as a query. It was difficult to determine which gene was an exact AtBAK1 ortholog, because many similar genes were identified<ref name="ref2" />. OsSERKs and OsBISERK1 cluster together, closer to each other than to any other AtSERKs based on amino acid sequence homology <ref name="ref4" />(Fig.7). | + | In order to search for AtBAK1 orthologs among the rice genes that were reported to be as OsSERKs or OsSERLs in the public database using the amino acid sequence of AtBAK1 as a query. It was difficult to determine which gene was an exact AtBAK1 ortholog, because many similar genes were identified<ref name="ref2" />. OsSERKs and OsBISERK1 cluster together, closer to each other than to any other AtSERKs based on amino acid sequence homology <ref name="ref4" />(Fig.7). |
| − | |||
===References=== | ===References=== | ||
Please input cited references here. | Please input cited references here. | ||
Latest revision as of 13:39, 21 March 2017
Please input one-sentence summary here.
Contents
Annotated Information
Function
The gene Os08g0174700 encode a somatic embryogenesis(SERK-family)receptor-like protein kinase 1(OsSERK1).Functionally, OsSERK1 is the closest homolog of AtBAK1 in rice. Therefore, we named it as OsBAK1( BRI1-Associated receptor Kinase 1)[1]. The expression of OsBAK1changed important agricultural traits of rice such as plant height, leaf erectness, grain morphologic features, and disease resistance responses. A new rice variety with erect-leaf and normal reproduction can be generated simply by suppressing the expression level of OsBAK1[1].
Reduceing levels of OsBAK1 and decreasing sensitivity to BL will lead to semidwarfism in overall growth and result in abnormal growth patterns(Fig.1)Expression
1.Expression of OsSERK1 and in various organs of rice
Using a set of OsSERK1 primers (K-1; 5’AT(CT)AT(ATC)CATCG(AT)GATGTCAA3’ and K6-2; 5’CCATCTTGGGGCGTTCTGTG3’, where nucleotides in parentheses are a mixture). Actin (RAc-1; 5’AACTGGGATGATATGGAGAA3’, RAc-2; 5’CCTCCAATCCAGACACTGTA3’) was used as an internal control. The result showed that OsSERK1 was expressed in all organs and calli examined with different levels.Expression of OsSERK1 was relatively strong in a 1 DAP flower which contained a very early embryo, a leaf blade and a shoot apex[3]. A callus on a regeneration medium with both cytokinin and auxin did not show significant change of the level of the OsSERK1expression in comparison to a callus on a callus-inducing medium(Fig.3 ).2.OsSERK genes were expressed in various organs but with some tissue specificity The OsSERK1 promoter showed reporter gene activities in some specific tissues in a germinating seed, leaf and root, but not in a developing embryo[3]. This promoter activity suggests that OsSERK1 may have roles in non-embryonic tissues rather than in the embryo[3].OsSERK1 might also be involved in signaling of or response to phytohormones in these tissues(Fig.4 ). 3.Rice SERKs are involved in BR signalling Overexpress the OsSERK1 rice gene in a weak BRI1 mutant,bri1-5.The transgenic Arabidopsis lines ectopically expressing OsSERK1 partially rescued the defective phenotypes of bri1-5(Fig.9).Compared to bri1-5, transgenic plants expressing OsSERK1 showed larger statures, longer petioles and earlier flowering phenotypes[1].The expression of CPD has been widely used as a molecular marker to detect the effectiveness of the BR signalling pathway [4]. BRI1 mutants usually show higher CPD expression levels than that of wild-type plants. Compared to bri1-5, the transgenic lines expressing OsSERKs showed significantly decreased expression of CPD (Fig.10).These results indicated that OsSERKs, like AtBAK1, can partially rescue bri1-5 mutant phenotypes.Functionally, OsSERK1 is the closest homolog of AtBAK1 in rice. Therefore, we named it as OsBAK1[1]. 4.The subcellular localization of OsBAK1 protein The OsBAK1 protein in onion epidermis cells is located at plasma membrane[1] (Fig.5) 5.OsBAK1 interacts with OsBRI1 in vivo Full length OsBAK1,the extracellular domain (OsBAK1-ECD), the intracellular domain (OsBAK1-ICD), and a truncated intracellular domain (OsBAK1-ICDD)(Fig.11)
Evolution
Phylogenetic analysis and suppression of a weak Arabidopsis mutant bri1-5 indicated that OsBAK1 (Os08g0174700) is the closest relative of Arabidopsis BAK1(AtBAK1). Genetic, physiological, and biochemical analyses all suggest that the function of OsBAK1 is conserved with AtBAK1[3](Fig.6). Phylogenetic analysis of SERK proteins in Arabidopsis and rice. In order to search for AtBAK1 orthologs among the rice genes that were reported to be as OsSERKs or OsSERLs in the public database using the amino acid sequence of AtBAK1 as a query. It was difficult to determine which gene was an exact AtBAK1 ortholog, because many similar genes were identified[2]. OsSERKs and OsBISERK1 cluster together, closer to each other than to any other AtSERKs based on amino acid sequence homology [5](Fig.7).
References
Please input cited references here.
- ↑ 1.0 1.1 1.2 1.3 1.4 Dan Li; Lei Wang; Min Wang; Yun-Yuan Xu; Wei Luo; Ya-Ju Liu; Zhi-Hong Xu; Jia Li; Kang Chong Engineering OsBAK1 gene as a molecular tool to improve rice architecture for high yield Plant Biotechnology Journal, 2009, 7(8): 791-806.
- ↑ 2.0 2.1 2.2 2.3 2.4 Hye Sun Park;Hee Young Ryu;Beg Hab Kim;Sun Young Kim;In Sun Yoon;Kyoung Hee Nam A subset of OsSERK genes, including OsBAK1, affects normal growth and leaf development of rice Molecules and Cells, 2011, 32(6): 561-569.
- ↑ 3.0 3.1 3.2 3.3 3.4 Yukihiro Ito; Kazuhiko Takaya; Nori Kurata Expression of SERK family receptor-like protein kinase genes in rice Biochimica et Biophysica Acta, 2005, 1730(3): 253-258.
- ↑ Albrecht, C., Russinova, E., Kemmerling, B., Kwaaitaal, M. and de Vries, S.C. (2008) Arabidopsis somatic embryogenesis receptor kinase proteins serve brassinosteroid dependent and independent signaling pathways. Plant Physiology, 148, 611–619.
- ↑ Guindon, S., and Gascuel, O.A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.Syst. Biol. 2003,52, 696-704.