|
|
| (5 intermediate revisions by 3 users not shown) |
| Line 1: |
Line 1: |
| − | {{JaponicaGene|
| + | The rice '''Os10g0390800''' was reported as ''' EBL1''' in 2011 <ref name="ref1" /> by researchers from the Japan. |
| − | GeneName = Os10g0390800|
| |
| − | Description = Similar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3)|
| |
| − | Version = NM_001071041.1 GI:115481825 GeneID:4348526|
| |
| − | Length = 1363 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os10g0390800, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| | | | |
| − | ORGANISM Oryza sativa Japonica Group
| + | ==Annotated Information== |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| + | ===Gene Symbol=== |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| + | *'''Os10g0390800 <=> EBL1''' |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| + | |
| − | |
| + | ===Function=== |
| − | Chromosome = [[:category:Japonica Chromosome 10|Chromosome 10]]|
| + | *'''EBL1''' is positively regulated by phytochrome B and associated with ACO1 upregulation. |
| − | AP = Chromosome 10:13348115..13349477|
| + | |
| − | CDS = 13348182..13348446,13348550..13349184|
| + | ===Mutant=== |
| − | GCID = <gbrowseImage1>
| + | *Since the OsEREBP1-like gene '''EBL1''' (OsEREBP1- LIKE 1) was significantly downregulated in phyAphyBphyC mutants, '''EBL1''' was suspected to repress ACO1 expression in wild-type plants. However, ACO1 was downregulated in EBL1 '''RNA''' interference plants,and the total length of these plants was slightly shorter than that of wild-type plants. |
| − | name=NC_008403:13348115..13349477
| + | |
| − | source=RiceChromosome10
| + | ==Labs working on this gene== |
| − | preset=GeneLocation
| + | *Division of Plant Sciences, Photobiology and Photosynthesis Research Unit,National Institute of Agrobiological Sciences, |
| − | </gbrowseImage1>|
| + | |
| − | GSID = <gbrowseImage2>
| + | ==References== |
| − | name=NC_008403:13348115..13349477
| + | <references> |
| − | source=RiceChromosome10
| + | <ref name="ref1"> |
| − | preset=GeneLocation
| + | Phytochrome-regulated EBL1 contributes to ACO1 upregulation in rice |
| − | </gbrowseImage2>| | + | </ref> |
| − | CDNA = <cdnaseq>atgtgcggcggcgcgatcctcgccgacctcataccgtcgccgcgctccggcggccacaccaaaaagaacaagcggcggcggatcagcgacgacgaggacttcgaggccgccttcgaggagttcgacgccggcgacgacgactccgactccgactccgagtccgaggaggtagacgagtacgacgtcgtcgtcgacgacgacgacagcgaggacggcgtggtggttcttccgccgccgccgccgccgccgccggtgattccacatgagcgccatggcgcgaggcggttccgcggcgtgaggaagcggccgtgggggaagtgggcggcggagatccgcgaccccgtgcgcggcgtgcgcgtctggctcggtaccttccccaccgccgagtccgccgcgcgcgcctacgacgccgccgcccgccgcctccgcggcgccaaggccaagcccaacttcccctccgcgccgccgccctcggctgctgctcaccgccgcaagaagcgccgcgcccacgccgccacgcgctcgccgtcgtctccgcccgccaccagcgaggtcacggcggcgtccgcgtccgcgtccagcgatgtccccgcgccggcgttcgcttccttcgtcggcgagcccgggcacggcggcgccaagtcgatgccgacgacgagccacacctcgcagccagccccgccggcgacggtggcgtccgagaacgtcgacgacccggaggtgttcgacccgtacgacgtccacggcggcctcgcctcctacttcgccggcggcgcgtacgagtccctggagagcctgttcgcgcacggcggcgacagcgccgccgtcgaccaagcggcgagcgaccactggccggcggcgctatggagcttcgcagacgacggctcgttctgcttctga</cdnaseq>|
| + | |
| − | AA = <aaseq>MCGGAILADLIPSPRSGGHTKKNKRRRISDDEDFEAAFEEFDAG DDDSDSDSESEEVDEYDVVVDDDDSEDGVVVLPPPPPPPPVIPHERHGARRFRGVRKR PWGKWAAEIRDPVRGVRVWLGTFPTAESAARAYDAAARRLRGAKAKPNFPSAPPPSAA AHRRKKRRAHAATRSPSSPPATSEVTAASASASSDVPAPAFASFVGEPGHGGAKSMPT TSHTSQPAPPATVASENVDDPEVFDPYDVHGGLASYFAGGAYESLESLFAHGGDSAAV DQAASDHWPAALWSFADDGSFCF</aaseq>|
| + | </references> |
| − | DNA = <dnaseqindica>68..332#436..1070#gtctcaaacccaatcaaactccaaccaaactcacctacctacccccaacccatccagagctagagctatgtgcggcggcgcgatcctcgccgacctcataccgtcgccgcgctccggcggccacaccaaaaagaacaagcggcggcggatcagcgacgacgaggacttcgaggccgccttcgaggagttcgacgccggcgacgacgactccgactccgactccgagtccgaggaggtagacgagtacgacgtcgtcgtcgacgacgacgacagcgaggacggcgtggtggttcttccgccgccgccgccgccgccgccggtgattccacatggtgaggcgatcgatcgatcaagaattggtttgcatcagctgcagaatttagcgtggactgagaggagtttcttgttgtgtttgtcttgtcttgaatcttgcagagcgccatggcgcgaggcggttccgcggcgtgaggaagcggccgtgggggaagtgggcggcggagatccgcgaccccgtgcgcggcgtgcgcgtctggctcggtaccttccccaccgccgagtccgccgcgcgcgcctacgacgccgccgcccgccgcctccgcggcgccaaggccaagcccaacttcccctccgcgccgccgccctcggctgctgctcaccgccgcaagaagcgccgcgcccacgccgccacgcgctcgccgtcgtctccgcccgccaccagcgaggtcacggcggcgtccgcgtccgcgtccagcgatgtccccgcgccggcgttcgcttccttcgtcggcgagcccgggcacggcggcgccaagtcgatgccgacgacgagccacacctcgcagccagccccgccggcgacggtggcgtccgagaacgtcgacgacccggaggtgttcgacccgtacgacgtccacggcggcctcgcctcctacttcgccggcggcgcgtacgagtccctggagagcctgttcgcgcacggcggcgacagcgccgccgtcgaccaagcggcgagcgaccactggccggcggcgctatggagcttcgcagacgacggctcgttctgcttctgatgctgtcaaatcacatcgccattggcggccattgcaagccatggcatggcacctgatgatgctgatccagtgaactggtcactcgttcttgatgcgttttcagtttcttgtacagtgtttttccccagcaacagtgaagtagtattcagttattcactgttcagtcatgagttcatcgcaaaatatgatgtaagtatgtgtcttgagattgttttagcagtggcttttgtttgtataatgtatttctctgtaattaattaatagctgttttcagtgataaactaaattttctg</dnaseqindica>|
| + | ==Structured Information== |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001071041.1 RefSeq:Os10g0390800]|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 10]] |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]] | |
| − | [[Category:Japonica Chromosome 10]]
| |
| − | [[Category:Chromosome 10]]
| |
