Difference between revisions of "Os11g0582500"

From RiceWiki
Jump to: navigation, search
(Annotated Information)
 
(14 intermediate revisions by 4 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice gene Os11g0582500 was reported as '''''OsC6''''' in 2010<ref name="ref1"/> by researchers from China.  
  
 
==Annotated Information==
 
==Annotated Information==
 +
[[File:Os11g0582500.png|277px|thumb|right]]
 +
===Gene Symbol===
 +
*'''''Os11g0582500''''' '''''<=>''''' '''''C6, OsC6, OsG6B, OsLTPG25'''''
 +
 
===Function===
 
===Function===
Please input function information here.
+
* '''''OsC6''''' Encoding a Lipid Transfer Protein.
 +
* '''''OsC6''''' is Required for Postmeiotic Anther Development, it functions in regulating postmeiotic anther development in rice.
 +
* ''''OsC6''''' plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice.
 +
 
 +
===Phenotypic analysis===
 +
* Plants in which OsC6 was silenced had defective development of orbicules (i.e. Ubisch bodies) and pollen exine and had reduced pollen fertility.
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
* '''''OsC6''''' expression is mainly detectable in tapetal cells and weakly in microspores from stage 9 to stage 11 of anther development.
 +
* Immunological assays indicated that '''''OsC6''''' is widely distributed in anther tissues such as the tapetal cytoplasm, the extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle.
 +
* Biochemical assays indicated that recombinant '''''OsC6''''' has lipid binding activity.
  
 
===Evolution===
 
===Evolution===
Please input evolution information here.
+
* '''''OsC6''''' belongs to a distinct clade from previously identified LTP1 and LTP2 family members found in both dicots and monocots.
 
 
You can also add sub-section(s) at will.
 
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
* School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
 +
* Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
  
 
==References==
 
==References==
Please input cited references here.
+
<references>
 +
<ref name="ref1">
 +
Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D. OsC6, encoding a lipid
 +
transfer protein, is required for postmeiotic anther development in rice. Plant
 +
Physiol. 2010 Sep;154(1):149-62. doi: 10.1104/pp.110.158865. Epub 2010 Jul 7.
 +
PubMed PMID: 20610705; PubMed Central PMCID: PMC2938136.
 +
</ref>
  
==Structured Information==
+
</references>
{{JaponicaGene|
 
GeneName = Os11g0582500|
 
Description = Similar to Anther specific protein|
 
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
 
Length = 1584 bp|
 
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
 
AP = Chromosome 11:23859388..23860971|
 
CDS = 23859461..23859815,23860411..23860454|
 
GCID = <gbrowseImage1>
 
name=NC_008404:23859388..23860971
 
source=RiceChromosome11
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008404:23859388..23860971
 
source=RiceChromosome11
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
 
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP                    FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC                    RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
 
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
 
}}
 
 
[[Category:Genes]]
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Japonica mRNA]]
Line 57: Line 43:
 
[[Category:Japonica Chromosome 11]]
 
[[Category:Japonica Chromosome 11]]
 
[[Category:Chromosome 11]]
 
[[Category:Chromosome 11]]
 +
 +
== Structured Information ==

Latest revision as of 10:20, 7 May 2017

The rice gene Os11g0582500 was reported as OsC6 in 2010[1] by researchers from China.

Annotated Information

Os11g0582500.png

Gene Symbol

  • Os11g0582500 <=> C6, OsC6, OsG6B, OsLTPG25

Function

  • OsC6 Encoding a Lipid Transfer Protein.
  • OsC6 is Required for Postmeiotic Anther Development, it functions in regulating postmeiotic anther development in rice.
  • 'OsC6 plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice.

Phenotypic analysis

  • Plants in which OsC6 was silenced had defective development of orbicules (i.e. Ubisch bodies) and pollen exine and had reduced pollen fertility.

Expression

  • OsC6 expression is mainly detectable in tapetal cells and weakly in microspores from stage 9 to stage 11 of anther development.
  • Immunological assays indicated that OsC6 is widely distributed in anther tissues such as the tapetal cytoplasm, the extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle.
  • Biochemical assays indicated that recombinant OsC6 has lipid binding activity.

Evolution

  • OsC6 belongs to a distinct clade from previously identified LTP1 and LTP2 family members found in both dicots and monocots.

Labs working on this gene

  • School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
  • Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China

References

  1. Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D. OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiol. 2010 Sep;154(1):149-62. doi: 10.1104/pp.110.158865. Epub 2010 Jul 7. PubMed PMID: 20610705; PubMed Central PMCID: PMC2938136.

Structured Information