Difference between revisions of "Os11g0582500"

From RiceWiki
Jump to: navigation, search
(→‎Evolution)
(→‎Annotated Information)
 
(11 intermediate revisions by 4 users not shown)
Line 1: Line 1:
−
Please input one-sentence summary here.
+
The rice gene Os11g0582500 was reported as '''''OsC6''''' in 2010<ref name="ref1"/> by researchers from China.  
  
 
==Annotated Information==
 
==Annotated Information==
 +
[[File:Os11g0582500.png|277px|thumb|right]]
 +
===Gene Symbol===
 +
*'''''Os11g0582500''''' '''''<=>''''' '''''C6, OsC6, OsG6B, OsLTPG25'''''
 +
 
===Function===
 
===Function===
−
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.
+
* '''''OsC6''''' Encoding a Lipid Transfer Protein.
 +
* '''''OsC6''''' is Required for Postmeiotic Anther Development, it functions in regulating postmeiotic anther development in rice.
 +
* ''''OsC6''''' plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice.
 +
 
 +
===Phenotypic analysis===
 +
* Plants in which OsC6 was silenced had defective development of orbicules (i.e. Ubisch bodies) and pollen exine and had reduced pollen fertility.
  
 
===Expression===
 
===Expression===
−
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).
+
* '''''OsC6''''' expression is mainly detectable in tapetal cells and weakly in microspores from stage 9 to stage 11 of anther development.  
 +
* Immunological assays indicated that '''''OsC6''''' is widely distributed in anther tissues such as the tapetal cytoplasm, the extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle.
 +
* Biochemical assays indicated that recombinant '''''OsC6''''' has lipid binding activity.
  
 
===Evolution===
 
===Evolution===
−
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys
+
* '''''OsC6''''' belongs to a distinct clade from previously identified LTP1 and LTP2 family members found in both dicots and monocots.
−
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.
 
  
 
==Labs working on this gene==
 
==Labs working on this gene==
−
Please input related labs here.
+
* School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
 +
* Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
  
 
==References==
 
==References==
−
Please input cited references here.
+
<references>
 +
<ref name="ref1">
 +
Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D. OsC6, encoding a lipid
 +
transfer protein, is required for postmeiotic anther development in rice. Plant
 +
Physiol. 2010 Sep;154(1):149-62. doi: 10.1104/pp.110.158865. Epub 2010 Jul 7.
 +
PubMed PMID: 20610705; PubMed Central PMCID: PMC2938136.
 +
</ref>
  
−
==Structured Information==
+
</references>
−
{{JaponicaGene|
 
−
GeneName = Os11g0582500|
 
−
Description = Similar to Anther specific protein|
 
−
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
 
−
Length = 1584 bp|
 
−
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
 
−
Source = Oryza sativa Japonica Group
 
  
−
  ORGANISM  Oryza sativa Japonica Group
 
−
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
−
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
−
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
−
|
 
−
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
 
−
AP = Chromosome 11:23859388..23860971|
 
−
CDS = 23859461..23859815,23860411..23860454|
 
−
GCID = <gbrowseImage1>
 
−
name=NC_008404:23859388..23860971
 
−
source=RiceChromosome11
 
−
preset=GeneLocation
 
−
</gbrowseImage1>|
 
−
GSID = <gbrowseImage2>
 
−
name=NC_008404:23859388..23860971
 
−
source=RiceChromosome11
 
−
preset=GeneLocation
 
−
</gbrowseImage2>|
 
−
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
 
−
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP                    FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC                    RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
 
−
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
 
−
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
 
−
}}
 
 
[[Category:Genes]]
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Japonica mRNA]]
Line 56: Line 43:
 
[[Category:Japonica Chromosome 11]]
 
[[Category:Japonica Chromosome 11]]
 
[[Category:Chromosome 11]]
 
[[Category:Chromosome 11]]
 +
 +
== Structured Information ==

Latest revision as of 10:20, 7 May 2017

The rice gene Os11g0582500 was reported as OsC6 in 2010[1] by researchers from China.

Annotated Information

Os11g0582500.png

Gene Symbol

  • Os11g0582500 <=> C6, OsC6, OsG6B, OsLTPG25

Function

  • OsC6 Encoding a Lipid Transfer Protein.
  • OsC6 is Required for Postmeiotic Anther Development, it functions in regulating postmeiotic anther development in rice.
  • 'OsC6 plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice.

Phenotypic analysis

  • Plants in which OsC6 was silenced had defective development of orbicules (i.e. Ubisch bodies) and pollen exine and had reduced pollen fertility.

Expression

  • OsC6 expression is mainly detectable in tapetal cells and weakly in microspores from stage 9 to stage 11 of anther development.
  • Immunological assays indicated that OsC6 is widely distributed in anther tissues such as the tapetal cytoplasm, the extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle.
  • Biochemical assays indicated that recombinant OsC6 has lipid binding activity.

Evolution

  • OsC6 belongs to a distinct clade from previously identified LTP1 and LTP2 family members found in both dicots and monocots.

Labs working on this gene

  • School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China
  • Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China

References

  1. ↑ Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D. OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiol. 2010 Sep;154(1):149-62. doi: 10.1104/pp.110.158865. Epub 2010 Jul 7. PubMed PMID: 20610705; PubMed Central PMCID: PMC2938136.

Structured Information

Retrieved from "https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0582500&oldid=277912"