Difference between revisions of "Os01g0274800"

From RiceWiki
Jump to: navigation, search
(Evolution)
 
(17 intermediate revisions by 3 users not shown)
Line 1: Line 1:
Please input one-sentence summary here.
+
The rice '''''Os01g0274800''''' was reported as '''''csa''''' in 2010 by researchers from China.  
  
 
==Annotated Information==
 
==Annotated Information==
 +
===Gene Symbol===
 +
*'''''Os01g0274800''''' '''''<=>''''' '''''CSA,csa,OsCSA'''''
 +
[[File:7-Os01g0274800.png|right|thumb|527px|'''Figure 1.''' ''Comparison of the Wild Type and the csa Mutant.<ref name="ref1" />.'']]
 +
 
===Function===
 
===Function===
Please input function information here.
+
* CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.
 +
* This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues.
 +
* CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development.
 +
* CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice<ref name="ref1" />.
  
 +
===Phenotypic analysis===
 +
*Carbon starved anther (csa), that showed increased sugar contents in leaves and stems and reduced levels of sugars and starch in floral organs. In particular, the csa mutant had reduced levels of carbohydrates in later anthers and was male sterile. The csa mutant had reduced accumulation of 14 C-labeled sugars in anther sink tissue.
 
===Expression===
 
===Expression===
Please input expression information here.
+
* The expression of MST8, encoding a monosaccharide transporter, was greatly reduced in csa anthers.
 +
* The CSA gene is preferentially expressed in the vascular tissue and the tapetum of the anther, as well as in other sinks<ref name="ref2" />.
 +
* The CSA transcripts were undetectable in stem and leaf, but detectable in root. In the sterile empty glume, which surrounds the rice flower, no CSA expression signal was observed.
 +
* Strong expression of CSA was detected in the lemma and palea and weaker expression in the pistil and seed.CSA is likely expressed in the anther wall layers at the early stages.<ref name="ref1" />
  
 
===Evolution===
 
===Evolution===
Please input evolution information here.
+
* CSA was located between two InDel markers Z134 and Z138, which define a region of 23 kb.
 
 
You can also add sub-section(s) at will.
 
  
 
==Labs working on this gene==
 
==Labs working on this gene==
Please input related labs here.
+
# School of Life Science and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China
 
+
# Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education, Shanghai Jiao Tong University, Shanghai 200240, China
 +
# Department of Horticulture, Michigan State University, East Lansing, Michigan 48824
 +
# State Key Laboratory of Genetic Engineering, Institute of Plant Biology, Center for Evolutionary Biology, School of Life Sciences, Fudan University, Shanghai 200433, China
 +
# Department of Biology, Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, Pennsylvania 16082
 
==References==
 
==References==
Please input cited references here.
+
<references>
 
+
<ref name="ref1">The Plant Cell, Vol. 22: 672–689, March 2010, www.plantcell.org ã 2010 American Society of Plant Biologists.Carbon Starved Anther Encodes a MYB Domain Protein That Regulates Sugar Partitioning Required for Rice Pollen Development.</ref>
 +
<ref name="ref2">Ohdan, T., Francisco, P.B., Jr., Sawada, T., Hirose, T., Terao, T., Satoh, H., and Nakamura, Y. (2005). Expression profiling of genes involved in starch synthesis in sink and source organs of rice. J. Exp. Bot. 56: 3229–3244.</ref>
 +
</references>
 
==Structured Information==
 
==Structured Information==
{{JaponicaGene|
 
GeneName = Os01g0274800|
 
Description = Conserved hypothetical protein|
 
Version = NM_001049255.1 GI:115435923 GeneID:4325181|
 
Length = 1665 bp|
 
Definition = Oryza sativa Japonica Group Os01g0274800, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza.
 
|
 
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
 
AP = Chromosome 1:9566484..9568148|
 
CDS = 9566915..9567077,9567297..9567751|
 
GCID = <gbrowseImage1>
 
name=NC_008394:9566484..9568148
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage1>|
 
GSID = <gbrowseImage2>
 
name=NC_008394:9566484..9568148
 
source=RiceChromosome01
 
preset=GeneLocation
 
</gbrowseImage2>|
 
CDNA = <cdnaseq>ggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaa</cdnaseq>|
 
AA = <aaseq>GGSTSWTRGLTGGRSRRRRRSGSWRRTGRTATSGRSSPASSPAA                    PTTPSRTTGTSSWRAATASSPAPSAAASLPPPPPPPPPPPRRRRRRSPSSRSTTTTTG                    TRSSTAGTAAPPSPTSRPPPAPPTSPSAPAAPRPPPPPPRRRTSPAASTSAAAPKPPP                    TATPSPSSTSSASARHDYRRRPPVVVVYRKEGRKEAAKIKRSKPS</aaseq>|
 
DNA = <dnaseqindica>1072..1234#398..852#catccatccattccagcatttcttgaagcttgctgtggatcagagaggatggctcacgagatgatgggtggcttcttcggccatccgccgccgccgcctgcgacggcggcggtgggtgaggaggaggacgaggtggtggaggagacggaggagggtggccatggcggaggagttcaggggaagctttgcgcgaggggacactggcggccggcggaggacgccaagctcaaggacctcgtcgcgcagtacggcccccagaactggaacctcatcgccgagaagctcgacggcagatcaggtaagagctcctccatggcggtgggtgcaatgcccaagaacgacgcgcattgaaggtgtttgtgatgggatggcatggcagggaagagctgcaggctgaggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagagcacgccgcgcgcctcttcctcttccaccgccgcgtgccgcgcgcctcgcgtcgcggcggcggctgacacggtggcgttcttccccggtgcaggctacgacttcgccgccgccccgcacgccatggctcccgcggcggcgtccacgttcgcgccgagcgcgcgctccgccttctccgccccggcgggccgcggcgagccccccggcgccgtcgaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaaggttagagttagccaagaacaagactaggacgaggaggaggaggaggaacaagacgtgctcgaagctcatcaatggcgttctcaaccaaacaagttttttctgctgctgctgctgctgcaagctagcttagattattcagatgaagaacaataagaagaagatgtagtactagtaaactagtaatggtgtgtgcgtttggaaatcaacaagcttccatgccatgccatgcctcctctgttcatcgatttcttttttttatctctctcctctgtatgaacaagtagaagaagaagaagaacaaattaatccattgctctcgcagatggatcagcaacatcaagcattgccgcattgtctctctctttgtgttcattgtccatgacgccaaagagaaaagaagaaaaattttcattgctctgttcttgaaatc</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001049255.1 RefSeq:Os01g0274800]|
 
}}
 
 
[[Category:Genes]]
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Japonica mRNA]]

Latest revision as of 16:15, 7 May 2017

The rice Os01g0274800 was reported as csa in 2010 by researchers from China.

Annotated Information

Gene Symbol

  • Os01g0274800 <=> CSA,csa,OsCSA
Figure 1. Comparison of the Wild Type and the csa Mutant.[1].

Function

  • CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.
  • This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues.
  • CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development.
  • CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice[1].

Phenotypic analysis

  • Carbon starved anther (csa), that showed increased sugar contents in leaves and stems and reduced levels of sugars and starch in floral organs. In particular, the csa mutant had reduced levels of carbohydrates in later anthers and was male sterile. The csa mutant had reduced accumulation of 14 C-labeled sugars in anther sink tissue.

Expression

  • The expression of MST8, encoding a monosaccharide transporter, was greatly reduced in csa anthers.
  • The CSA gene is preferentially expressed in the vascular tissue and the tapetum of the anther, as well as in other sinks[2].
  • The CSA transcripts were undetectable in stem and leaf, but detectable in root. In the sterile empty glume, which surrounds the rice flower, no CSA expression signal was observed.
  • Strong expression of CSA was detected in the lemma and palea and weaker expression in the pistil and seed.CSA is likely expressed in the anther wall layers at the early stages.[1]

Evolution

  • CSA was located between two InDel markers Z134 and Z138, which define a region of 23 kb.

Labs working on this gene

  1. School of Life Science and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China
  2. Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education, Shanghai Jiao Tong University, Shanghai 200240, China
  3. Department of Horticulture, Michigan State University, East Lansing, Michigan 48824
  4. State Key Laboratory of Genetic Engineering, Institute of Plant Biology, Center for Evolutionary Biology, School of Life Sciences, Fudan University, Shanghai 200433, China
  5. Department of Biology, Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, Pennsylvania 16082

References

  1. 1.0 1.1 1.2 The Plant Cell, Vol. 22: 672–689, March 2010, www.plantcell.org ã 2010 American Society of Plant Biologists.Carbon Starved Anther Encodes a MYB Domain Protein That Regulates Sugar Partitioning Required for Rice Pollen Development.
  2. Ohdan, T., Francisco, P.B., Jr., Sawada, T., Hirose, T., Terao, T., Satoh, H., and Nakamura, Y. (2005). Expression profiling of genes involved in starch synthesis in sink and source organs of rice. J. Exp. Bot. 56: 3229–3244.

Structured Information