|
|
| (2 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| − | Please input one-sentence summary here.
| + | The rice '''''Os08g0556900''''' was reported as '''''OsSAG12-2''''' in 2016 <ref name="ref1" /> by researchers from India. |
| | | | |
| | ==Annotated Information== | | ==Annotated Information== |
| | + | ===Gene Symbol=== |
| | + | *'''''Os08g0556900''''' '''''<=>''''' '''''OsSAG12-2''''' '''''SAG12-2''''' |
| | ===Function=== | | ===Function=== |
| − | Please input function information here.
| + | *'''''OsSAG12-2''''' codes for a functional protease that negatively regulates stress-induced cell death in rice. |
| | | | |
| − | ===Expression=== | + | ===Phenotypic analysis=== |
| − | Please input expression information here.
| + | *Dark-induced senescence activates '''''OsSAG12-2''''' expression. |
| | + | *Down-regulation of '''''OsSAG12-2''''' in the transgenic artificial miRNA lines results in enhanced salt- and UV-induced cell death, even though it does not affect cell viability in the stress-free condition. |
| | | | |
| − | ===Evolution===
| |
| − | Please input evolution information here.
| |
| | | | |
| | You can also add sub-section(s) at will. | | You can also add sub-section(s) at will. |
| | | | |
| | ==Labs working on this gene== | | ==Labs working on this gene== |
| − | Please input related labs here.
| + | *School of Life Sciences, Jawaharlal Nehru University, New Delhi 110 067, India |
| | | | |
| | ==References== | | ==References== |
| − | Please input cited references here.
| + | <references> |
| | + | * <ref name="ref1"> |
| | + | Singh S, Singh A, Nandi AK. The rice OsSAG12-2 gene codes for a functional protease that negatively regulates stress-induced cell death. J Biosci. 2016 Sep;41(3):445-53. PubMed PMID: 27581936. |
| | + | </ref> |
| | + | </references> |
| | + | |
| | | | |
| | ==Structured Information== | | ==Structured Information== |
| − | {{JaponicaGene|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 8]] |
| − | GeneName = Os08g0556900|
| |
| − | Description = Similar to Cysteine proteinase (EC 3.4.22.-)|
| |
| − | Version = NM_001069014.1 GI:115477766 GeneID:4346292|
| |
| − | Length = 1436 bp|
| |
| − | Definition = Oryza sativa Japonica Group Os08g0556900, complete gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Chromosome 8|Chromosome 8]]|
| |
| − | AP = Chromosome 8:27963147..27964582|
| |
| − | CDS = 27963224..27964381|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_008401:27963147..27964582
| |
| − | source=RiceChromosome08
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_008401:27963147..27964582
| |
| − | source=RiceChromosome08
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | CDNA = <cdnaseq>atgggtagagtagtggtcgtcgtggcggcggcggcggtagccgtggccgtcgtcgtgctgctgggcgcggcggcgccggcggcgagcgcgatggagttcggcgacaaggacgtggcgtcggaggaggcgctgtgggagctgtacgagcggtggcgcgggcagcaccgggtggcgcgggacctcggcgagaaggcgcggcggttcaacgtgttcaaggacaacgtccgcctcatccacgagttcaaccgccgcgacgagccctacaagctccgcctcaaccgcttcggcgacatgaccgccgacgagttccgccgcgcctacgcctcctcccgcgtctcccaccaccgcatgttccgcggccgcggcgagaggcgcagcggcttcatgtacgccggcgcccgcgacctgccggcggcggtggactggcgcgagaagggcgccgtcggggcggtcaaggaccagggccagtgcggcagctgctgggcgttctcgaccatcgccgccgtggaagggatcaacgccatccgcaccagcaacctcaccgcgctgtcggagcagcagctcgtcgactgcgacaccaagaccggcaacgccggctgcgacggcggcctcatggacaacgcgttccagtacatcgccaagcacggcggcgtcgccgcctcctccgcctacccgtaccgcgcccgccagagctcctgcaagagctccgcggcgtcgtcccccgccgtcaccatcgacggctacgaggacgtgccggcgaactcggagtcggcgctgaagaaggcggtggcgaaccagccggtgtcggtggcgatcgaggcggggggctcgcacttccagttctactcggagggggtgttcgccgggaaatgcgggacggagctcgaccatggcgtggcggcggtgggctacggcacgacggtggacggcaccaagtactggatcgtcaggaactcgtggggcgcagactggggtgagaagggctacatccggatgaagcgcgacgtgtccgccaaggagggactctgcggcatcgccatggaagcatcctaccccatcaagacctcgccgaacccggcgcccaagaagatcaagaaggtcaccgacgacgacgaagatgatgatgacgaggagcaccgccaccacgacgaactctaa</cdnaseq>|
| |
| − | AA = <aaseq>MGRVVVVVAAAAVAVAVVVLLGAAAPAASAMEFGDKDVASEEAL WELYERWRGQHRVARDLGEKARRFNVFKDNVRLIHEFNRRDEPYKLRLNRFGDMTADE FRRAYASSRVSHHRMFRGRGERRSGFMYAGARDLPAAVDWREKGAVGAVKDQGQCGSC WAFSTIAAVEGINAIRTSNLTALSEQQLVDCDTKTGNAGCDGGLMDNAFQYIAKHGGV AASSAYPYRARQSSCKSSAASSPAVTIDGYEDVPANSESALKKAVANQPVSVAIEAGG SHFQFYSEGVFAGKCGTELDHGVAAVGYGTTVDGTKYWIVRNSWGADWGEKGYIRMKR DVSAKEGLCGIAMEASYPIKTSPNPAPKKIKKVTDDDEDDDDEEHRHHDEL</aaseq>|
| |
| − | DNA = <dnaseqindica>78..1235#accaccacctcacaagctaattcaacctactaagctagctagctagtgacaattaagtgatcacaagtgttgttgcgatgggtagagtagtggtcgtcgtggcggcggcggcggtagccgtggccgtcgtcgtgctgctgggcgcggcggcgccggcggcgagcgcgatggagttcggcgacaaggacgtggcgtcggaggaggcgctgtgggagctgtacgagcggtggcgcgggcagcaccgggtggcgcgggacctcggcgagaaggcgcggcggttcaacgtgttcaaggacaacgtccgcctcatccacgagttcaaccgccgcgacgagccctacaagctccgcctcaaccgcttcggcgacatgaccgccgacgagttccgccgcgcctacgcctcctcccgcgtctcccaccaccgcatgttccgcggccgcggcgagaggcgcagcggcttcatgtacgccggcgcccgcgacctgccggcggcggtggactggcgcgagaagggcgccgtcggggcggtcaaggaccagggccagtgcggcagctgctgggcgttctcgaccatcgccgccgtggaagggatcaacgccatccgcaccagcaacctcaccgcgctgtcggagcagcagctcgtcgactgcgacaccaagaccggcaacgccggctgcgacggcggcctcatggacaacgcgttccagtacatcgccaagcacggcggcgtcgccgcctcctccgcctacccgtaccgcgcccgccagagctcctgcaagagctccgcggcgtcgtcccccgccgtcaccatcgacggctacgaggacgtgccggcgaactcggagtcggcgctgaagaaggcggtggcgaaccagccggtgtcggtggcgatcgaggcggggggctcgcacttccagttctactcggagggggtgttcgccgggaaatgcgggacggagctcgaccatggcgtggcggcggtgggctacggcacgacggtggacggcaccaagtactggatcgtcaggaactcgtggggcgcagactggggtgagaagggctacatccggatgaagcgcgacgtgtccgccaaggagggactctgcggcatcgccatggaagcatcctaccccatcaagacctcgccgaacccggcgcccaagaagatcaagaaggtcaccgacgacgacgaagatgatgatgacgaggagcaccgccaccacgacgaactctaagctcatttaattgtgtgttttacaacagtaactggctaccgtttggaggcgattgatcgacgtcgtaacaaaataagcagttcgttaatttaatcacctgtagttgatttgattgcatgctcgtattttttgcaatctagctcgattatgtttacgctgtgtaatgattattgattattaatttgaaaaagattgttaagt</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001069014.1 RefSeq:Os08g0556900]|
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]] | |
| − | [[Category:Japonica Chromosome 8]]
| |
| − | [[Category:Chromosome 8]]
| |
