|
|
| (8 intermediate revisions by one other user not shown) |
| Line 3: |
Line 3: |
| | ==Annotated Information== | | ==Annotated Information== |
| | ===Function=== | | ===Function=== |
| − | ATP synthase in the plant mitochondrial endomembrane consists of F O and F1 parts and plays an important role in energy formation. As the intramembrane compartment of the enzyme, FO consisting of four subunits, orf25, orfB, atp6 and atp9, and functions as a transporter of H+ through the membrane. Changes in DNA sequence within the atp6 and atp9 genes, as well as in their upstream or downstream regions, were known to be closely related to male sterility in plants.
| + | Please input function information here. |
| − | | |
| | | | |
| | ===Expression=== | | ===Expression=== |
| Line 20: |
Line 19: |
| | Please input cited references here. | | Please input cited references here. |
| | | | |
| − | {{Mitochondrion|
| + | ==Structured Information== |
| − | GeneName = orf25|
| + | [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]] |
| − | Description = hypothetical protein|
| |
| − | Version = GeneID:6450126|
| |
| − | Length = 594 bp|
| |
| − | Definition = Oryza sativa Japonica Group ''orf25'', Mitochondrion gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − | | |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
| |
| − | AP = Mitochondrion:18402..18995|
| |
| − | CDS = 18402..18995|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_011033:18402..18995
| |
| − | source=Rice_Japonica_Mitochondrion
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_011033:18402..18995
| |
| − | source=Rice_Japonica_Mitochondrion
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | AA = <aaseq>MGLSSTDKKDRRNMLFAAILFICALSSKKILIYNEEMIVACCFIGFLIFSRKSLGKTFKETLDGRIESIQEELQQFFNPNEVILGESNEQQRLLRISLRICSAVVESLPTARCAPKCEKTVQALLCRNLNVKLATLLNAISSRRIRLQDDIVTGFHFSVSERFVSGSTFKASTVEQIREAFVPIDLIREGLIVLRKV</aaseq>|
| |
| − | DNA = <dnaseqindica>1..594#atgggattgagttcaacggataagaaggatagaagaaatatgctatttgctgctattccatctatttgtgcatcaagtccgaagaagatctcaatctataatgaagaaatgatagtagctcgttgttttataggctttctcatattcagtcggaagagtttaggtaagactttcaaagaaactctcgacgggagaatcgagtctattcaggaagaattgcagcaattcttcaatcctaacgaagtaattccgggggaatccaatgaacaacaacgattacttaggatcagcttgcgaatttgcagcgccgtagtagaatcattaccaacggcacgctgtgcgcctaagtgcgaaaagacagtgcaagctttgttatgccgaaacctaaatgtaaagtcagcaacacttctaaatgccacttcttcccgtcgcatccgtcttcaggacgatatagttacaggttttcacttttcagtgagtgaaagatttgtatccgggtctacgttcaaagcttctactgtagaacaaattcgagaggccttcgtacccatagacctaattcgggaaggcttgatagtcctaagaaaggtgtag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450126 NCBI Gene:orf25]
| |
| − | }}
| |
| − | [[Category:Genes]] | |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]] | |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Mitochondrion]] | |
| − | [[Category:Mitochondrion]]
| |
Please input one-sentence summary here.
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
