Difference between revisions of "Wbph8"
(Created page with "''WbpH8'', short for glycosyltransferase8, is a kind of enzyme which catalyzes the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, fo...") |
(→Function) |
||
| Line 6: | Line 6: | ||
The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. | The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. | ||
A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers. | A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers. | ||
| − | |||
===location=== | ===location=== | ||
Latest revision as of 09:16, 25 June 2016
WbpH8, short for glycosyltransferase8, is a kind of enzyme which catalyzes the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate.
Contents
Annotated Information
Function
WbpH8is a recessive gene associated with resistance to Whitebacked planthopper in rice.Function proposed based on presence of conserved amino acid motif, structural feature or limited sequence similarity to an experimentally studied gene. The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively.
A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.
location
QTL analysis based on the data of the severity scores of RIL population confirmed the presence of the two WBPH resistance genes, and further determined their locations. One was mapped to a 1.1-cM length interval on the end of the long arm of chromosome 3, with an LOD score of 6.13, flanked by R1925 and G1318. This locus can explain 9.61% of the phenotypic variance of WBPH resistance in the population. We designated it as Wbph7(t). The other, designated as Wbph8(t), was resolved with an LOD score of 18.44 to a 0.3-cM interval between R288 and S11182 on the short arm close to the centromeric region of chromosome 4 . This locus accounted for 34.76% of the phenotypic variance of WBPH resistance in the population. The two QTLs jointly contributed 44.36% of the phenotypic variance of WBPH resistance in this population . Also, the same resistance loci against BPH were detected on chromosome 3 and 4 by whole genome scanning, individually explaining 14.79 and 28.77% of the total variation in the RIL population, and collectively 43.56%.
expression
Sequence: NC_002516.2 (3532812..3533933, complement) NC_002516.2
DNA SEQUENCE
gi|110645304:c3533933-3532812 Pseudomonas aeruginosa PAO1 chromosome, complete genome ATGACTAAAGTTGCTCATTTGACATCGGTTCACTCGCGTTATGATATTCGTATATTTCGAAAGCAGTGTA GAACACTCTCTCAATACGGATACGATGTGTATCTGGTTGTCGCAGATGGTAAGGGTGATGAAGTCAAGGA TGGTGTAAGGATTGTTGATGTCGGAGTACTCTCAGGTCGCTTGAATCGTATTCTAAAAACCACCCGAAAA ATTTATGAACAGGCTTTGGCGCTTGGGGCTGATGTCTATCATTTTCATGATCCCGAACTGATACCTGTTG GTCTTCGACTGAAAAAGCAAGGTAAGCAGGTTATCTTCGACTCCCATGAGGATGTGCCGAAGCAACTGCT GAGTAAACCTTACATGCGACCGTTTTTACGCCGTGTAGTGGCTGTGTTATTTTCCTGCTATGAGAAATAT GCATGCCCTAAGCTGGATGCAGTCCTTACGGCAACGCCGCATATTCGTGAAAAATTTAAAAATATTAATG GGAATGTTCTAGATATTAATAACTTTCCCATGTTGGGTGAGTTGGATGCGATGGTTCCTTGGGCAAGCAA GAAAACTGAAGTCTGCTACGTCGGTGGTATCACTTCCATTCGTGGTGTTCGTGAAGTCGTTAAGAGTCTT GAGTGCTTGAAGTCCTCGGCGCGCTTGAATTTAGTGGGAAAGTTTTCAGAGCCAGAGATAGAAAAAGAAG TCAGAGCGCTCAAGGGATGGAACTCCGTTAACGAACATGGTCAGCTTGATCGAGAAGATGTTCGTCGTGT ACTCGGTGACTCTGTTGCCGGGTTGGTGACATTTCTCCCAATGCCTAATCATGTTGATGCACAACCTAAT AAGATGTTCGAGTATATGTCGTCGGGAATCCCTGTGATCGCTTCCAATTTTCCTCTCTGGCGGGAAATTG TTGAAGGTAGCAATTGTGGTATATGCGTAGATCCTCTAAGTCCTGCTGCCATTGCTGAAGCGATCGACTA TCTGGTAAGTAATCCGTGTGAGGCGGCAGCGCTGGGACGTAATGGCCAGCGGGCAGTGAACGAACGTTAT AACTGGGATTTGGAAGGGCGCAAACTAGCGCGGTTCTATTCCGATCTACTGAGTAAGCGAGATTCCATAT GA
Labs working on this gene
Key Laboratory of the Ministry of Education for Plant Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072, People's Republic of Chin
References
G X Tan1, Q M Weng1, X Ren1, Z Huang1, L L Zhu1 and G C He1.Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.Heredity (2004) 92, 212–217