Difference between revisions of "Os01g0610050"

From RiceWiki
Jump to: navigation, search
(Created page with "{{JaponicaGene| GeneName = Os01g0610050| Description = Hypothetical protein| Version = NM_001185532.1 GI:297720198 GeneID:9267416| Length = 462 bp| Definition = Oryza sat...")
 
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
{{JaponicaGene|
+
Please input one-sentence summary here.
GeneName = Os01g0610050|
 
Description = Hypothetical protein|
 
Version = NM_001185532.1 GI:297720198 GeneID:9267416|
 
Length = 462 bp|
 
Definition = Oryza sativa Japonica Group Os01g0610050, complete gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
+
==Annotated Information==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
===Function===
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
Please input function information here.
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
 
|
+
===Expression===
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
+
Please input expression information here.
AP = Chromosome 1:25781700..25782161|
+
 
CDS = 25781700..25781724,25782127..25782161|
+
===Evolution===
GCID = <gbrowseImage1>
+
Please input evolution information here.
name=NC_008394:25781700..25782161
+
 
source=RiceChromosome01
+
You can also add sub-section(s) at will.
preset=GeneLocation
+
 
</gbrowseImage1>|
+
==Labs working on this gene==
GSID = <gbrowseImage2>
+
Please input related labs here.
name=NC_008394:25781700..25782161
+
 
source=RiceChromosome01
+
==References==
preset=GeneLocation
+
Please input cited references here.
</gbrowseImage2>|
+
 
CDNA = <cdnaseq>atggggagacgcagcttcatcggcggtgggggcttggatccaggaattgcttctttctag</cdnaseq>|
+
==Structured Information==
AA = <aaseq>MGRRSFIGGGGLDPGIASF</aaseq>|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]]
DNA = <dnaseqindica>438..462#1..35#atggggagacgcagcttcatcggcggtgggggcttgtatgcctaattgcttatcattcccggaagatttgatgcggttgcttgatgcacgagccgcgttggtgaaggcaaacaacactgcatttcttttttttctctaggttcttgctatgttcatgcactgcttttcttttttctctgggttcttgccatgtttatgctgttgccagtagtactagtattttctcaattggagagattttctttttaagtatttgctttcggcaatggaaacttttggcattttttattctgcgtcatatgcttctggcatgtgtaatcaatagatgcagagaaatgacatatgtaatcaacagatgcagagaaatgacagtaatatatggatgttgtcacggagggtattttcatcattttacattagtactaaatttgcatcagggatccaggaattgcttctttctag</dnaseqindica>|
 
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001185532.1 RefSeq:Os01g0610050]|
 
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Chromosome 1]]
 
[[Category:Chromosome 1]]
 

Latest revision as of 04:49, 14 May 2015

Please input one-sentence summary here.

Annotated Information

Function

Please input function information here.

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information