Difference between revisions of "BGIOSGA029617"
(→Annotated Information) |
|||
| Line 3: | Line 3: | ||
==Annotated Information== | ==Annotated Information== | ||
===Function=== | ===Function=== | ||
| − | + | Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells | |
===Expression=== | ===Expression=== | ||
| − | + | qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. We also speculated that it was involved in panicle development(Fig. [[File:Example.jpg]] | |
| − | + | Fig. 1 Expression pattern of OsZHD1. a. qRT-PCR of OsZHD1 transcription levels in different organs in WT. GUS activity was detected in GUS lines root (b), seedling (c), leaf sheath (d), leaf blade (e), glumes of young panicle (h) and flowering spikes (i), while not in negative line leaf blade (f), glumes of young panicle (g). qRT-PCR analysis of OsZHD1 expression in WT developing leaves (j) and developing panicles (k). | |
| − | |||
| − | |||
| − | |||
| − | |||
==Labs working on this gene== | ==Labs working on this gene== | ||
Revision as of 05:17, 28 May 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells
Expression
qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. We also speculated that it was involved in panicle development(Fig.
Fig. 1 Expression pattern of OsZHD1. a. qRT-PCR of OsZHD1 transcription levels in different organs in WT. GUS activity was detected in GUS lines root (b), seedling (c), leaf sheath (d), leaf blade (e), glumes of young panicle (h) and flowering spikes (i), while not in negative line leaf blade (f), glumes of young panicle (g). qRT-PCR analysis of OsZHD1 expression in WT developing leaves (j) and developing panicles (k).
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
BGIOSGA029617 |
|---|---|
| Description |
Putative uncharacterized protein |
| Definition |
Oryza sativa Indica Group BGIOSGA029617, complete gene. |
| LocusTag |
OJ1005_D12.28 |
| Ensembl Transcript ID |
BGIOSGA029617-TA |
| Ensembl Protein ID |
BGIOSGA029617-PA |
| Length |
840 |
| Source |
Oryza sativa Indica Group ORGANISM Oryza sativa Indica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 9:16349452..16350291 |
| Sequence Coding Region |
16349452..16350291 |
| Genome Context |
<gbrowseImage1> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</cdnaseq> |
| Protein Sequence |
<aaseq>MDFDDHDDGDEEMPPMPVSSSYETPPQHGLAGGGMAPKPPGEIGSHVKGPSCGGGRYRECLKNHAVGIGGHAVDGCGEFMAAGEEGTIDALRCAACNCHRNFHRKESESLAGEGSPFSPAAVVPYGATPHHQFSPYYRTPAGYLHHHQHHMAAAAAAAAAAAGGHPQRPLALPSTSHSGRDDGDDLSGMVGPMSAVGPLSGMSLGAGPSGSGSGKKRFRTKFTQEQKDKMLAFAERVGWRIQKHDEAAVQQFCDEVGVKRHVLKVWMHNNKHTLGKKLP</aaseq> |
| Gene Sequence |
<dnaseqindica>1..840#ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</dnaseqindica> |
| External Link(s) |