Difference between revisions of "Atp1"
| Line 4: | Line 4: | ||
Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the | Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the | ||
rice mitochondrial atp1 gene is also regulated in different ways.| | rice mitochondrial atp1 gene is also regulated in different ways.| | ||
| − | + | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | |
Description = ATP synthase F0 subunit 1| | Description = ATP synthase F0 subunit 1| | ||
Version = GeneID:6450183| | Version = GeneID:6450183| | ||
Revision as of 11:39, 20 May 2014
| Gene Name |
atp1 |
|---|---|
| Description |
ATP synthase F0 subunit 1 |
| Version |
GeneID:6450183 |
| Length |
1530 bp |
| Definition |
Oryza sativa Japonica Group atp1, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:352379..353908 |
| Sequence Coding Region |
352379..353908 |
| Genome Context |
<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq> |
| Gene Sequence |
<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica> |
| External Link(s) |
